Incidental Mutation 'R6433:Flcn'
ID518651
Institutional Source Beutler Lab
Gene Symbol Flcn
Ensembl Gene ENSMUSG00000032633
Gene Namefolliculin
SynonymsB430214A04Rik, BHD
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location59791408-59810016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59801082 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 247 (D247G)
Ref Sequence ENSEMBL: ENSMUSP00000099758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047706] [ENSMUST00000091246] [ENSMUST00000102697]
Predicted Effect probably benign
Transcript: ENSMUST00000047706
SMART Domains Protein: ENSMUSP00000037675
Gene: ENSMUSG00000032633

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091246
AA Change: D247G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091696
Gene: ENSMUSG00000032633
AA Change: D247G

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 103 267 3.5e-59 PFAM
low complexity region 293 308 N/A INTRINSIC
PDB:3V42|B 342 566 1e-144 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000102697
AA Change: D247G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099758
Gene: ENSMUSG00000032633
AA Change: D247G

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 104 265 1.5e-55 PFAM
low complexity region 293 308 N/A INTRINSIC
Pfam:Folliculin_C 344 566 8.4e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148151
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two different knock-out alleles exhibit prenatal lethality. Mice homozygous for a gene-trapped allele show prenatal lethality while a fraction of heterozygotes develop spontaneous oncocytic renal cysts and solid renal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Flcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Flcn APN 11 59795823 missense probably damaging 1.00
IGL01890:Flcn APN 11 59795170 missense probably benign 0.00
IGL02486:Flcn APN 11 59801043 nonsense probably null
IGL02933:Flcn APN 11 59803757 missense probably damaging 1.00
IGL02935:Flcn APN 11 59795236 missense possibly damaging 0.93
IGL03246:Flcn APN 11 59794110 missense possibly damaging 0.82
Pansy UTSW 11 59792659 missense probably damaging 0.99
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0265:Flcn UTSW 11 59795809 nonsense probably null
R0534:Flcn UTSW 11 59794199 splice site probably benign
R0551:Flcn UTSW 11 59795748 critical splice donor site probably null
R1016:Flcn UTSW 11 59795865 critical splice acceptor site probably null
R1108:Flcn UTSW 11 59801200 missense possibly damaging 0.77
R2350:Flcn UTSW 11 59792659 missense probably damaging 0.99
R4158:Flcn UTSW 11 59801121 missense probably benign 0.26
R4367:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4371:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4612:Flcn UTSW 11 59792687 missense probably damaging 1.00
R4689:Flcn UTSW 11 59801044 missense possibly damaging 0.87
R5849:Flcn UTSW 11 59804760 missense probably damaging 0.99
R6007:Flcn UTSW 11 59792622 missense probably benign 0.08
R6525:Flcn UTSW 11 59794172 missense possibly damaging 0.75
R7027:Flcn UTSW 11 59795806 missense probably damaging 1.00
R7632:Flcn UTSW 11 59795799 nonsense probably null
R8018:Flcn UTSW 11 59794122 missense probably damaging 0.97
X0002:Flcn UTSW 11 59804537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTGTCTCCATCCGGTGAG -3'
(R):5'- TAGACTGCTGCCAAGAGAGC -3'

Sequencing Primer
(F):5'- TCCGGTGAGGAGACAGAC -3'
(R):5'- GGTGGCAGTAAGGCTCG -3'
Posted On2018-05-24