Incidental Mutation 'R6433:Galnt16'
ID 518655
Institutional Source Beutler Lab
Gene Symbol Galnt16
Ensembl Gene ENSMUSG00000021130
Gene Name polypeptide N-acetylgalactosaminyltransferase 16
Synonyms Galntl1, 5730405L21Rik
MMRRC Submission 044571-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R6433 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 80565245-80650672 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80622677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 127 (V127A)
Ref Sequence ENSEMBL: ENSMUSP00000151829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021558] [ENSMUST00000218943] [ENSMUST00000219993]
AlphaFold Q9JJ61
Predicted Effect probably benign
Transcript: ENSMUST00000021558
AA Change: V127A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021558
Gene: ENSMUSG00000021130
AA Change: V127A

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
low complexity region 29 46 N/A INTRINSIC
Pfam:Glycos_transf_2 126 308 1.2e-24 PFAM
Pfam:Glyco_tranf_2_2 126 356 1.6e-9 PFAM
Pfam:Glyco_transf_7C 277 352 2.2e-10 PFAM
Blast:RICIN 362 395 1e-10 BLAST
RICIN 432 555 1.41e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218943
AA Change: V127A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219993
AA Change: V127A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.5550 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 14,101,561 (GRCm39) D1016E probably damaging Het
Aplnr A T 2: 84,967,017 (GRCm39) Q14L probably benign Het
Aspm T C 1: 139,401,421 (GRCm39) L1147S probably damaging Het
Atad2b A G 12: 5,002,642 (GRCm39) T337A possibly damaging Het
Atrn A G 2: 130,864,947 (GRCm39) E1358G probably damaging Het
Caml C A 13: 55,771,062 (GRCm39) S53R possibly damaging Het
Cd180 T G 13: 102,842,141 (GRCm39) S396A probably benign Het
Cdhr2 A G 13: 54,866,325 (GRCm39) T344A probably damaging Het
Cyp4a31 A C 4: 115,427,466 (GRCm39) D224A probably damaging Het
Dhx36 T C 3: 62,392,395 (GRCm39) T544A probably damaging Het
Dnah14 A G 1: 181,479,222 (GRCm39) K1528E probably damaging Het
Dnpep T A 1: 75,292,022 (GRCm39) K199N probably benign Het
Dsc2 C T 18: 20,184,232 (GRCm39) probably null Het
Efl1 T A 7: 82,323,776 (GRCm39) D239E probably damaging Het
Elovl4 A G 9: 83,667,231 (GRCm39) V42A possibly damaging Het
Exoc3 T C 13: 74,337,306 (GRCm39) T432A possibly damaging Het
Fam98c A G 7: 28,855,553 (GRCm39) probably null Het
Fbln2 G A 6: 91,210,254 (GRCm39) G66D probably damaging Het
Fchsd1 G A 18: 38,097,137 (GRCm39) T410I possibly damaging Het
Flcn T C 11: 59,691,908 (GRCm39) D247G probably damaging Het
H2-Ob A T 17: 34,462,860 (GRCm39) probably null Het
Has2 G A 15: 56,531,194 (GRCm39) S507F possibly damaging Het
Ido2 T A 8: 25,023,939 (GRCm39) M300L probably damaging Het
Itga10 T C 3: 96,565,357 (GRCm39) probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Mfsd2a A G 4: 122,844,250 (GRCm39) V299A probably benign Het
Mybpc1 T C 10: 88,396,217 (GRCm39) D210G probably damaging Het
Ndrg1 A T 15: 66,805,721 (GRCm39) M128K probably damaging Het
Obscn T A 11: 58,942,384 (GRCm39) T5091S probably benign Het
Or2j3 A G 17: 38,616,304 (GRCm39) L16P probably damaging Het
Pex5 A T 6: 124,390,572 (GRCm39) M91K possibly damaging Het
Phlpp2 G T 8: 110,661,317 (GRCm39) A810S probably benign Het
Pla2g7 G C 17: 43,910,017 (GRCm39) A174P probably damaging Het
Plxna4 C T 6: 32,192,613 (GRCm39) V783M probably damaging Het
Poll A T 19: 45,542,043 (GRCm39) M421K probably benign Het
Ppfia2 C A 10: 106,749,559 (GRCm39) S1148R possibly damaging Het
Prkg1 A G 19: 30,758,746 (GRCm39) F280S probably benign Het
Rdh10 G A 1: 16,178,079 (GRCm39) C117Y probably damaging Het
Rtl1 C A 12: 109,561,630 (GRCm39) A70S unknown Het
Scgb2b3 A T 7: 31,058,492 (GRCm39) L104I probably benign Het
Sh3tc1 T C 5: 35,863,941 (GRCm39) R749G probably damaging Het
Skint4 A G 4: 112,003,707 (GRCm39) K380R probably benign Het
Smtnl1 A C 2: 84,648,712 (GRCm39) S181A probably benign Het
Spata31d1b T C 13: 59,864,999 (GRCm39) S716P probably damaging Het
Spc25 A G 2: 69,036,446 (GRCm39) probably benign Het
Stab2 C T 10: 86,737,431 (GRCm39) probably null Het
Timm22 T C 11: 76,300,570 (GRCm39) V114A possibly damaging Het
Timp4 A G 6: 115,224,181 (GRCm39) C163R probably damaging Het
Toporsl T A 4: 52,611,548 (GRCm39) N480K possibly damaging Het
Tpo T C 12: 30,134,753 (GRCm39) E735G probably benign Het
Trpm3 A G 19: 22,878,669 (GRCm39) D692G probably damaging Het
Ttn T C 2: 76,582,058 (GRCm39) H22945R probably damaging Het
Vmn2r6 A T 3: 64,454,801 (GRCm39) Y499* probably null Het
Vwa1 G A 4: 155,857,226 (GRCm39) H191Y probably benign Het
Other mutations in Galnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Galnt16 APN 12 80,639,264 (GRCm39) splice site probably null
IGL02614:Galnt16 APN 12 80,623,337 (GRCm39) missense probably damaging 0.99
PIT4504001:Galnt16 UTSW 12 80,639,191 (GRCm39) nonsense probably null
R0032:Galnt16 UTSW 12 80,639,243 (GRCm39) missense probably damaging 1.00
R1109:Galnt16 UTSW 12 80,637,405 (GRCm39) missense probably benign
R1560:Galnt16 UTSW 12 80,648,566 (GRCm39) missense possibly damaging 0.77
R1595:Galnt16 UTSW 12 80,637,410 (GRCm39) missense probably damaging 0.99
R1991:Galnt16 UTSW 12 80,630,430 (GRCm39) missense probably damaging 1.00
R2103:Galnt16 UTSW 12 80,630,430 (GRCm39) missense probably damaging 1.00
R4866:Galnt16 UTSW 12 80,630,851 (GRCm39) missense probably damaging 1.00
R4972:Galnt16 UTSW 12 80,619,103 (GRCm39) nonsense probably null
R5140:Galnt16 UTSW 12 80,628,073 (GRCm39) missense possibly damaging 0.94
R5228:Galnt16 UTSW 12 80,630,822 (GRCm39) missense probably damaging 1.00
R5414:Galnt16 UTSW 12 80,630,822 (GRCm39) missense probably damaging 1.00
R5592:Galnt16 UTSW 12 80,635,293 (GRCm39) missense probably damaging 1.00
R6634:Galnt16 UTSW 12 80,565,944 (GRCm39) start codon destroyed probably null 0.95
R7021:Galnt16 UTSW 12 80,626,826 (GRCm39) missense probably damaging 0.99
R7534:Galnt16 UTSW 12 80,643,909 (GRCm39) missense probably damaging 0.99
R7567:Galnt16 UTSW 12 80,628,084 (GRCm39) critical splice donor site probably null
R7681:Galnt16 UTSW 12 80,637,413 (GRCm39) missense probably damaging 1.00
R7802:Galnt16 UTSW 12 80,628,021 (GRCm39) missense probably damaging 1.00
R7983:Galnt16 UTSW 12 80,648,598 (GRCm39) missense probably benign 0.00
R8678:Galnt16 UTSW 12 80,630,822 (GRCm39) missense probably damaging 0.98
R8750:Galnt16 UTSW 12 80,644,879 (GRCm39) missense probably benign 0.18
R8944:Galnt16 UTSW 12 80,623,314 (GRCm39) missense probably damaging 1.00
R9386:Galnt16 UTSW 12 80,644,880 (GRCm39) missense probably damaging 0.99
Z1177:Galnt16 UTSW 12 80,648,584 (GRCm39) missense probably damaging 1.00
Z1177:Galnt16 UTSW 12 80,619,121 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCAGGCTCTATCCTAGCTTTGAG -3'
(R):5'- ACAAGACTTAGCCTCCTAGAGC -3'

Sequencing Primer
(F):5'- AGGCTCTATCCTAGCTTTGAGAATTC -3'
(R):5'- TAGAGCTTGCCTCCACAGTG -3'
Posted On 2018-05-24