Incidental Mutation 'R6433:Cdhr2'
ID518657
Institutional Source Beutler Lab
Gene Symbol Cdhr2
Ensembl Gene ENSMUSG00000034918
Gene Namecadherin-related family member 2
SynonymsLOC268663, Pcdh24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location54701461-54736662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54718512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 344 (T344A)
Ref Sequence ENSEMBL: ENSMUSP00000043596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145]
Predicted Effect probably damaging
Transcript: ENSMUST00000037145
AA Change: T344A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918
AA Change: T344A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin family, which represents a subset of the larger cadherin superfamily. The members of the protocadherin family encode non-classical cadherins that function as calcium-dependent cell-cell adhesion molecules. This protocadherin represents a new candidate for tumor suppression. Alternatively spliced transcript variants that encode the same protein have been identified. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Cdhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cdhr2 APN 13 54718299 missense probably damaging 1.00
IGL00596:Cdhr2 APN 13 54720997 missense probably damaging 0.97
IGL00840:Cdhr2 APN 13 54720152 missense probably damaging 0.96
IGL00956:Cdhr2 APN 13 54718343 missense probably damaging 1.00
IGL01101:Cdhr2 APN 13 54718135 splice site probably benign
IGL01150:Cdhr2 APN 13 54731118 missense probably benign
IGL01412:Cdhr2 APN 13 54725894 missense probably damaging 1.00
IGL01515:Cdhr2 APN 13 54718238 missense probably benign 0.17
IGL02005:Cdhr2 APN 13 54719763 missense probably benign 0.00
IGL02187:Cdhr2 APN 13 54733710 missense possibly damaging 0.86
IGL02312:Cdhr2 APN 13 54717888 missense probably null 0.97
IGL02877:Cdhr2 APN 13 54734737 missense probably benign 0.39
IGL03072:Cdhr2 APN 13 54726661 missense probably benign 0.00
IGL03263:Cdhr2 APN 13 54718113 missense possibly damaging 0.75
FR4449:Cdhr2 UTSW 13 54725924 small insertion probably benign
PIT4494001:Cdhr2 UTSW 13 54718442 critical splice acceptor site probably null
PIT4498001:Cdhr2 UTSW 13 54718239 missense possibly damaging 0.75
R0041:Cdhr2 UTSW 13 54726838 missense probably damaging 1.00
R0149:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0329:Cdhr2 UTSW 13 54734801 unclassified probably benign
R0361:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0365:Cdhr2 UTSW 13 54718292 missense probably benign 0.00
R0598:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R0774:Cdhr2 UTSW 13 54717855 missense probably damaging 1.00
R1330:Cdhr2 UTSW 13 54734268 missense possibly damaging 0.67
R1458:Cdhr2 UTSW 13 54717872 missense probably damaging 0.99
R1659:Cdhr2 UTSW 13 54719761 missense probably damaging 1.00
R1698:Cdhr2 UTSW 13 54719581 missense probably benign 0.00
R2061:Cdhr2 UTSW 13 54720818 missense probably damaging 1.00
R2098:Cdhr2 UTSW 13 54715644 missense probably benign 0.15
R2135:Cdhr2 UTSW 13 54720947 missense probably damaging 1.00
R2365:Cdhr2 UTSW 13 54718088 missense probably benign 0.01
R3693:Cdhr2 UTSW 13 54726416 missense probably damaging 1.00
R3968:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R3970:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R4001:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4003:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4030:Cdhr2 UTSW 13 54717861 missense probably damaging 1.00
R4088:Cdhr2 UTSW 13 54717888 missense probably null 0.97
R4256:Cdhr2 UTSW 13 54714005 missense probably damaging 0.99
R4322:Cdhr2 UTSW 13 54733721 missense probably benign 0.00
R4396:Cdhr2 UTSW 13 54715665 missense probably damaging 0.99
R4591:Cdhr2 UTSW 13 54715684 missense probably benign 0.18
R4726:Cdhr2 UTSW 13 54718539 missense probably damaging 0.99
R5370:Cdhr2 UTSW 13 54720887 missense probably damaging 1.00
R5396:Cdhr2 UTSW 13 54736456 missense probably benign
R5447:Cdhr2 UTSW 13 54733250 missense probably damaging 1.00
R5654:Cdhr2 UTSW 13 54736536 missense probably benign
R5727:Cdhr2 UTSW 13 54724308 missense possibly damaging 0.95
R5771:Cdhr2 UTSW 13 54726695 missense probably damaging 0.99
R5924:Cdhr2 UTSW 13 54726683 missense probably benign 0.01
R5928:Cdhr2 UTSW 13 54734019 missense probably benign 0.01
R6246:Cdhr2 UTSW 13 54719710 missense probably damaging 1.00
R6351:Cdhr2 UTSW 13 54726776 missense probably benign 0.16
R6358:Cdhr2 UTSW 13 54736546 missense probably damaging 0.99
R7044:Cdhr2 UTSW 13 54733321 nonsense probably null
R7341:Cdhr2 UTSW 13 54719492 missense probably damaging 0.99
R7462:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R7488:Cdhr2 UTSW 13 54717915 missense probably benign 0.28
R7763:Cdhr2 UTSW 13 54717692 missense probably damaging 1.00
R7771:Cdhr2 UTSW 13 54718275 missense probably damaging 1.00
R8050:Cdhr2 UTSW 13 54734222 missense probably damaging 0.96
R8069:Cdhr2 UTSW 13 54731070 missense probably damaging 1.00
R8070:Cdhr2 UTSW 13 54719793 missense probably benign 0.13
Z1177:Cdhr2 UTSW 13 54715671 missense probably damaging 1.00
Z1177:Cdhr2 UTSW 13 54718564 missense probably damaging 1.00
Z1177:Cdhr2 UTSW 13 54726408 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCATCTTCGTCAATGGCTCC -3'
(R):5'- TGCCTGGTCTGGATCATAGG -3'

Sequencing Primer
(F):5'- GCAGCTGCTTCTGGAAAAC -3'
(R):5'- TCTGGATCATAGGCCACCATG -3'
Posted On2018-05-24