Incidental Mutation 'R6433:Spata31d1b'
ID518659
Institutional Source Beutler Lab
Gene Symbol Spata31d1b
Ensembl Gene ENSMUSG00000091311
Gene Namespermatogenesis associated 31 subfamily D, member 1B
SynonymsFam75d1b, Gm4934
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59712284-59719295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59717185 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 716 (S716P)
Ref Sequence ENSEMBL: ENSMUSP00000130813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165133]
Predicted Effect probably damaging
Transcript: ENSMUST00000165133
AA Change: S716P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130813
Gene: ENSMUSG00000091311
AA Change: S716P

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 65 149 3.9e-10 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 206 229 N/A INTRINSIC
low complexity region 352 360 N/A INTRINSIC
Pfam:FAM75 402 774 1.1e-116 PFAM
low complexity region 883 895 N/A INTRINSIC
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1152 1162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Spata31d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Spata31d1b APN 13 59712466 missense probably benign 0.06
IGL02317:Spata31d1b APN 13 59718040 missense probably damaging 0.99
IGL02885:Spata31d1b APN 13 59719127 utr 3 prime probably benign
R0017:Spata31d1b UTSW 13 59716069 missense probably benign
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0595:Spata31d1b UTSW 13 59716277 missense probably benign 0.09
R0961:Spata31d1b UTSW 13 59717804 missense possibly damaging 0.91
R1054:Spata31d1b UTSW 13 59717518 missense probably damaging 0.96
R1124:Spata31d1b UTSW 13 59716654 missense probably benign
R1338:Spata31d1b UTSW 13 59718161 frame shift probably null
R1539:Spata31d1b UTSW 13 59715919 missense possibly damaging 0.46
R1662:Spata31d1b UTSW 13 59716628 missense probably benign 0.00
R1688:Spata31d1b UTSW 13 59715460 missense possibly damaging 0.61
R1776:Spata31d1b UTSW 13 59716567 missense probably benign
R1793:Spata31d1b UTSW 13 59715965 missense probably benign
R1838:Spata31d1b UTSW 13 59715857 missense probably benign
R1838:Spata31d1b UTSW 13 59717465 missense probably benign 0.00
R1861:Spata31d1b UTSW 13 59717336 missense possibly damaging 0.64
R1903:Spata31d1b UTSW 13 59718068 missense probably damaging 0.99
R1940:Spata31d1b UTSW 13 59718021 missense possibly damaging 0.91
R1994:Spata31d1b UTSW 13 59716380 missense probably benign
R1995:Spata31d1b UTSW 13 59716380 missense probably benign
R2407:Spata31d1b UTSW 13 59716846 missense possibly damaging 0.64
R3692:Spata31d1b UTSW 13 59717891 missense probably benign 0.03
R4576:Spata31d1b UTSW 13 59716861 missense probably damaging 0.98
R4734:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4742:Spata31d1b UTSW 13 59716612 missense probably damaging 0.98
R4749:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4806:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4808:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4844:Spata31d1b UTSW 13 59718355 missense possibly damaging 0.85
R4942:Spata31d1b UTSW 13 59717103 missense possibly damaging 0.70
R4953:Spata31d1b UTSW 13 59716283 missense probably damaging 0.96
R5093:Spata31d1b UTSW 13 59716024 missense possibly damaging 0.84
R5169:Spata31d1b UTSW 13 59716495 missense probably damaging 1.00
R5384:Spata31d1b UTSW 13 59718218 missense possibly damaging 0.68
R5386:Spata31d1b UTSW 13 59719052 missense possibly damaging 0.95
R5502:Spata31d1b UTSW 13 59716672 missense probably damaging 1.00
R5751:Spata31d1b UTSW 13 59718973 missense probably benign 0.03
R6054:Spata31d1b UTSW 13 59715650 missense probably benign
R6571:Spata31d1b UTSW 13 59717455 missense probably benign
R6980:Spata31d1b UTSW 13 59715422 missense probably benign 0.26
R7047:Spata31d1b UTSW 13 59712435 missense probably damaging 1.00
R7064:Spata31d1b UTSW 13 59716141 missense probably benign
R7147:Spata31d1b UTSW 13 59718214 missense probably benign 0.28
R7273:Spata31d1b UTSW 13 59717632 missense probably benign
R7359:Spata31d1b UTSW 13 59712490 missense probably damaging 1.00
R7457:Spata31d1b UTSW 13 59716909 missense probably damaging 0.99
R7469:Spata31d1b UTSW 13 59715464 missense probably benign 0.04
R7519:Spata31d1b UTSW 13 59716912 missense probably benign 0.43
R7548:Spata31d1b UTSW 13 59716654 missense probably benign
R7586:Spata31d1b UTSW 13 59718380 missense probably damaging 1.00
R7657:Spata31d1b UTSW 13 59715763 missense possibly damaging 0.46
R7778:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
R7824:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
R8078:Spata31d1b UTSW 13 59715449 missense probably damaging 0.99
Z1177:Spata31d1b UTSW 13 59712409 missense probably damaging 1.00
Z1177:Spata31d1b UTSW 13 59715451 missense probably benign 0.44
Z1177:Spata31d1b UTSW 13 59718860 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGGGACTCTCTTGGATCACTTTC -3'
(R):5'- TTGCCATGTTCACAGAATGCC -3'

Sequencing Primer
(F):5'- GGATCACTTTCTTTAAGTACCAAGGC -3'
(R):5'- TGTTCACAGAATGCCTCGAC -3'
Posted On2018-05-24