Incidental Mutation 'R6433:Cd180'
ID518661
Institutional Source Beutler Lab
Gene Symbol Cd180
Ensembl Gene ENSMUSG00000021624
Gene NameCD180 antigen
SynonymsLy78, RP105
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location102693558-102739629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102705633 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 396 (S396A)
Ref Sequence ENSEMBL: ENSMUSP00000022124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]
PDB Structure
Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022124
AA Change: S396A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: S396A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 76 99 1.07e0 SMART
LRR 193 221 1.76e2 SMART
LRR 297 320 1.66e1 SMART
Pfam:LRR_8 321 382 4.2e-13 PFAM
LRR 395 418 3e1 SMART
LRR 444 467 3.09e1 SMART
LRR 495 518 4.97e0 SMART
LRR 519 542 2.4e1 SMART
low complexity region 555 567 N/A INTRINSIC
LRRCT 577 626 5.11e-8 SMART
transmembrane domain 628 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167144
SMART Domains Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171267
SMART Domains Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 2e-38 PDB
SCOP:d1m0za_ 35 84 9e-4 SMART
Blast:LRR 51 75 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Cd180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cd180 APN 13 102705409 missense probably benign
IGL00949:Cd180 APN 13 102693760 missense possibly damaging 0.89
IGL01864:Cd180 APN 13 102706033 missense possibly damaging 0.93
IGL01901:Cd180 APN 13 102706428 missense probably benign 0.04
IGL01934:Cd180 APN 13 102702858 missense probably damaging 1.00
IGL01998:Cd180 APN 13 102705214 missense probably damaging 0.99
IGL02336:Cd180 APN 13 102705313 missense probably damaging 0.98
IGL03031:Cd180 APN 13 102705027 missense probably benign 0.00
IGL03139:Cd180 APN 13 102706416 missense probably damaging 1.00
Volte_face UTSW 13 102704923 missense probably damaging 0.99
H8562:Cd180 UTSW 13 102705418 missense probably benign 0.02
R0004:Cd180 UTSW 13 102702708 missense probably benign 0.00
R0393:Cd180 UTSW 13 102705900 missense probably damaging 0.99
R0565:Cd180 UTSW 13 102702874 intron probably benign
R1080:Cd180 UTSW 13 102706220 nonsense probably null
R1223:Cd180 UTSW 13 102706222 missense possibly damaging 0.49
R1669:Cd180 UTSW 13 102705490 missense probably damaging 1.00
R1772:Cd180 UTSW 13 102706242 missense probably benign 0.11
R1784:Cd180 UTSW 13 102705859 missense probably damaging 1.00
R1865:Cd180 UTSW 13 102706009 missense probably benign
R2252:Cd180 UTSW 13 102706398 nonsense probably null
R2385:Cd180 UTSW 13 102705183 missense probably benign 0.00
R4653:Cd180 UTSW 13 102704908 missense probably damaging 1.00
R4695:Cd180 UTSW 13 102705760 missense probably benign 0.01
R4790:Cd180 UTSW 13 102702822 missense probably damaging 0.98
R4934:Cd180 UTSW 13 102739164 critical splice acceptor site probably null
R5052:Cd180 UTSW 13 102704895 missense probably benign
R5154:Cd180 UTSW 13 102705774 missense probably damaging 1.00
R5469:Cd180 UTSW 13 102704834 missense probably benign 0.37
R5493:Cd180 UTSW 13 102706141 missense probably benign 0.07
R5615:Cd180 UTSW 13 102706203 missense probably benign 0.34
R5905:Cd180 UTSW 13 102706033 missense possibly damaging 0.93
R6282:Cd180 UTSW 13 102693757 missense possibly damaging 0.90
R6456:Cd180 UTSW 13 102702836 missense probably damaging 1.00
R6784:Cd180 UTSW 13 102702705 missense probably damaging 0.97
R6815:Cd180 UTSW 13 102705429 missense probably damaging 1.00
R6838:Cd180 UTSW 13 102702731 missense probably benign 0.38
R6941:Cd180 UTSW 13 102706191 missense probably benign 0.23
R7048:Cd180 UTSW 13 102704923 missense probably damaging 0.99
R7338:Cd180 UTSW 13 102706428 missense probably benign 0.04
R7466:Cd180 UTSW 13 102704995 missense probably damaging 1.00
R7647:Cd180 UTSW 13 102705943 missense probably damaging 1.00
Z1176:Cd180 UTSW 13 102705766 missense probably damaging 1.00
Z1177:Cd180 UTSW 13 102706032 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACTTGTGGGACTAAGCACAC -3'
(R):5'- TGGGAGAGATTCAGCACCTTC -3'

Sequencing Primer
(F):5'- CTTGTGGGACTAAGCACACTTAAG -3'
(R):5'- TTCAGCACCTTCAAAAGATGGAG -3'
Posted On2018-05-24