Incidental Mutation 'R6433:Has2'
ID518662
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Namehyaluronan synthase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location56665627-56694539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56667798 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 507 (S507F)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050544
AA Change: S507F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: S507F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Meta Mutation Damage Score 0.1004 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56681676 missense possibly damaging 0.51
IGL02027:Has2 APN 15 56668171 missense probably damaging 1.00
IGL02178:Has2 APN 15 56682060 missense probably damaging 1.00
IGL02493:Has2 APN 15 56667924 missense probably damaging 1.00
IGL02533:Has2 APN 15 56681695 missense probably benign 0.00
IGL03142:Has2 APN 15 56682095 missense possibly damaging 0.92
IGL03240:Has2 APN 15 56668260 missense probably damaging 1.00
R0189:Has2 UTSW 15 56668435 missense probably damaging 1.00
R0362:Has2 UTSW 15 56681661 missense probably damaging 1.00
R1377:Has2 UTSW 15 56681806 missense probably damaging 1.00
R1762:Has2 UTSW 15 56681610 missense probably benign 0.13
R1845:Has2 UTSW 15 56668578 missense probably damaging 1.00
R2012:Has2 UTSW 15 56667868 missense probably damaging 1.00
R2190:Has2 UTSW 15 56667787 missense probably benign 0.00
R2656:Has2 UTSW 15 56681828 missense possibly damaging 0.90
R2966:Has2 UTSW 15 56682137 missense probably damaging 1.00
R4361:Has2 UTSW 15 56681948 missense probably damaging 1.00
R5698:Has2 UTSW 15 56667916 missense probably damaging 1.00
R5826:Has2 UTSW 15 56668102 missense probably damaging 1.00
R5883:Has2 UTSW 15 56668063 missense possibly damaging 0.49
R5942:Has2 UTSW 15 56667796 nonsense probably null
R6560:Has2 UTSW 15 56668264 missense probably damaging 1.00
R6603:Has2 UTSW 15 56668572 missense probably damaging 1.00
R7094:Has2 UTSW 15 56681621 missense probably damaging 1.00
R7597:Has2 UTSW 15 56668421 missense probably damaging 1.00
R7738:Has2 UTSW 15 56667712 missense possibly damaging 0.89
R8060:Has2 UTSW 15 56669945 missense probably benign 0.00
Z1177:Has2 UTSW 15 56681583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATACTGTATAGCCCCTTGAGGAG -3'
(R):5'- GCCAAGATGTTTGCAATTGC -3'

Sequencing Primer
(F):5'- CTGTATAGCCCCTTGAGGAGCTAAG -3'
(R):5'- TTGCAACCATAAACAAAGCTGGGTG -3'
Posted On2018-05-24