Incidental Mutation 'R6433:H2-Ob'
ID518665
Institutional Source Beutler Lab
Gene Symbol H2-Ob
Ensembl Gene ENSMUSG00000041538
Gene Namehistocompatibility 2, O region beta locus
SynonymsOb, H-2Ob, H2-Ab, A-beta2, A-beta-2, H-2I, H2-IAb2, H2-Ab2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34238903-34245907 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 34243886 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095342] [ENSMUST00000095342] [ENSMUST00000167280] [ENSMUST00000167280] [ENSMUST00000173764]
Predicted Effect probably null
Transcript: ENSMUST00000095342
SMART Domains Protein: ENSMUSP00000092985
Gene: ENSMUSG00000041538

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
MHC_II_beta 39 113 8.17e-34 SMART
IGc1 138 209 2.24e-24 SMART
transmembrane domain 225 247 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095342
SMART Domains Protein: ENSMUSP00000092985
Gene: ENSMUSG00000041538

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
MHC_II_beta 39 113 8.17e-34 SMART
IGc1 138 209 2.24e-24 SMART
transmembrane domain 225 247 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167280
SMART Domains Protein: ENSMUSP00000129657
Gene: ENSMUSG00000041538

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
MHC_II_beta 39 113 8.17e-34 SMART
IGc1 120 183 4.55e-16 SMART
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167280
SMART Domains Protein: ENSMUSP00000129657
Gene: ENSMUSG00000041538

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
MHC_II_beta 39 113 8.17e-34 SMART
IGc1 120 183 4.55e-16 SMART
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173681
Predicted Effect probably benign
Transcript: ENSMUST00000173764
AA Change: S197C

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133906
Gene: ENSMUSG00000041538
AA Change: S197C

DomainStartEndE-ValueType
Pfam:MHC_II_beta 1 42 8e-12 PFAM
IGc1 67 138 2.24e-24 SMART
transmembrane domain 154 176 N/A INTRINSIC
Meta Mutation Damage Score 0.9582 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DOB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DOA) and a beta chain (DOB), both anchored in the membrane. It is located in intracellular vesicles. DO suppresses peptide loading of MHC class II molecules by inhibiting HLA-DM. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in H2-Ob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:H2-Ob APN 17 34242545 missense probably damaging 1.00
IGL03247:H2-Ob APN 17 34243492 missense probably benign
Deciduous UTSW 17 34243886 critical splice acceptor site probably null
K3955:H2-Ob UTSW 17 34241184 missense probably damaging 1.00
R0466:H2-Ob UTSW 17 34242659 missense probably damaging 0.99
R0791:H2-Ob UTSW 17 34242614 missense probably damaging 1.00
R0792:H2-Ob UTSW 17 34242614 missense probably damaging 1.00
R0812:H2-Ob UTSW 17 34244126 utr 3 prime probably benign
R2145:H2-Ob UTSW 17 34242580 missense probably benign 0.00
R4677:H2-Ob UTSW 17 34242644 missense probably benign 0.01
R4741:H2-Ob UTSW 17 34242571 missense possibly damaging 0.73
R5011:H2-Ob UTSW 17 34241279 critical splice donor site probably null
R5084:H2-Ob UTSW 17 34241128 missense probably damaging 1.00
R5135:H2-Ob UTSW 17 34243516 missense probably benign 0.20
R5497:H2-Ob UTSW 17 34241170 missense probably benign 0.42
R6034:H2-Ob UTSW 17 34241218 missense probably damaging 1.00
R6034:H2-Ob UTSW 17 34241218 missense probably damaging 1.00
R6272:H2-Ob UTSW 17 34242644 missense probably benign 0.01
R6794:H2-Ob UTSW 17 34241188 missense possibly damaging 0.96
R7220:H2-Ob UTSW 17 34241260 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGAACCTTCCCACCTG -3'
(R):5'- TCTTGAGGCCTGCAAGAAGAG -3'

Sequencing Primer
(F):5'- CCTTTACTGTAAAGATCTGAGGGAG -3'
(R):5'- TGTCAGGAGGCCTCACAC -3'
Posted On2018-05-24