Mutagenetix > Incidental Mutations

Incidental Mutation 'R6433:Trpm3'

518670

Institutional Source

Beutler Lab

Gene Symbol

Trpm3

Ensembl Gene

ENSMUSG00000052387

Gene Name

transient receptor potential cation channel, subfamily M, member 3

Synonyms

B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R6433 (G1)

Quality Score

219.009

Status

Validated

Chromosome

Chromosomal Location

22139119-22989884 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22901305 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 692 (D692G)

Ref Sequence

ENSEMBL: ENSMUSP00000074328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099564] [ENSMUST00000099569]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037901
AA Change: D700G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: D700G

Domain	Start	End	E-Value	Type
Blast:ANK	485	514	1e-6	BLAST
low complexity region	619	631	N/A	INTRINSIC
low complexity region	674	689	N/A	INTRINSIC
low complexity region	788	800	N/A	INTRINSIC
low complexity region	821	840	N/A	INTRINSIC
Pfam:Ion_trans	883	1136	1.7e-19	PFAM
Pfam:TRPM_tetra	1227	1282	1.5e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000074770
AA Change: D692G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: D692G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	611	623	N/A	INTRINSIC
low complexity region	666	681	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	813	832	N/A	INTRINSIC
transmembrane domain	874	896	N/A	INTRINSIC
Pfam:Ion_trans	908	1116	5.1e-14	PFAM
low complexity region	1378	1388	N/A	INTRINSIC
low complexity region	1433	1455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000087576
AA Change: D702G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: D702G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	621	633	N/A	INTRINSIC
low complexity region	676	691	N/A	INTRINSIC
low complexity region	790	802	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC
transmembrane domain	884	906	N/A	INTRINSIC
Pfam:Ion_trans	918	1126	5.1e-14	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099564
AA Change: D532G

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000097160
Gene: ENSMUSG00000052387
AA Change: D532G

Domain	Start	End	E-Value	Type
low complexity region	451	463	N/A	INTRINSIC
low complexity region	506	521	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	653	672	N/A	INTRINSIC
transmembrane domain	714	736	N/A	INTRINSIC
Pfam:Ion_trans	748	919	1.5e-13	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099569
AA Change: D690G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: D690G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	6e-7	BLAST
low complexity region	609	621	N/A	INTRINSIC
low complexity region	664	679	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	811	830	N/A	INTRINSIC
Pfam:Ion_trans	873	1138	3.2e-19	PFAM
Pfam:TRPM_tetra	1229	1284	4.4e-26	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Meta Mutation Damage Score

0.3050

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	T	A	17: 13,881,299	D1016E	probably damaging	Het
Aplnr	A	T	2: 85,136,673	Q14L	probably benign	Het
Aspm	T	C	1: 139,473,683	L1147S	probably damaging	Het
Atad2b	A	G	12: 4,952,642	T337A	possibly damaging	Het
Atrn	A	G	2: 131,023,027	E1358G	probably damaging	Het
Caml	C	A	13: 55,623,249	S53R	possibly damaging	Het
Cd180	T	G	13: 102,705,633	S396A	probably benign	Het
Cdhr2	A	G	13: 54,718,512	T344A	probably damaging	Het
Cyp4a31	A	C	4: 115,570,269	D224A	probably damaging	Het
Dhx36	T	C	3: 62,484,974	T544A	probably damaging	Het
Dnah14	A	G	1: 181,651,657	K1528E	probably damaging	Het
Dnpep	T	A	1: 75,315,378	K199N	probably benign	Het
Dsc2	C	T	18: 20,051,175		probably null	Het
Efl1	T	A	7: 82,674,568	D239E	probably damaging	Het
Elovl4	A	G	9: 83,785,178	V42A	possibly damaging	Het
Exoc3	T	C	13: 74,189,187	T432A	possibly damaging	Het
Fam98c	A	G	7: 29,156,128		probably null	Het
Fbln2	G	A	6: 91,233,272	G66D	probably damaging	Het
Fchsd1	G	A	18: 37,964,084	T410I	possibly damaging	Het
Flcn	T	C	11: 59,801,082	D247G	probably damaging	Het
Galnt16	T	C	12: 80,575,903	V127A	probably benign	Het
H2-Ob	A	T	17: 34,243,886		probably null	Het
Has2	G	A	15: 56,667,798	S507F	possibly damaging	Het
Ido2	T	A	8: 24,533,923	M300L	probably damaging	Het
Itga10	T	C	3: 96,658,041		probably null	Het
Klra9	G	T	6: 130,179,032	Y253*	probably null	Het
Mfsd2a	A	G	4: 122,950,457	V299A	probably benign	Het
Mybpc1	T	C	10: 88,560,355	D210G	probably damaging	Het
Ndrg1	A	T	15: 66,933,872	M128K	probably damaging	Het
Obscn	T	A	11: 59,051,558	T5091S	probably benign	Het
Olfr137	A	G	17: 38,305,413	L16P	probably damaging	Het
Pex5	A	T	6: 124,413,613	M91K	possibly damaging	Het
Phlpp2	G	T	8: 109,934,685	A810S	probably benign	Het
Pla2g7	G	C	17: 43,599,126	A174P	probably damaging	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Poll	A	T	19: 45,553,604	M421K	probably benign	Het
Ppfia2	C	A	10: 106,913,698	S1148R	possibly damaging	Het
Prkg1	A	G	19: 30,781,346	F280S	probably benign	Het
Rdh10	G	A	1: 16,107,855	C117Y	probably damaging	Het
Rtl1	C	A	12: 109,595,196	A70S	unknown	Het
Scgb2b3	A	T	7: 31,359,067	L104I	probably benign	Het
Sh3tc1	T	C	5: 35,706,597	R749G	probably damaging	Het
Skint4	A	G	4: 112,146,510	K380R	probably benign	Het
Smtnl1	A	C	2: 84,818,368	S181A	probably benign	Het
Spata31d1b	T	C	13: 59,717,185	S716P	probably damaging	Het
Spc25	A	G	2: 69,206,102		probably benign	Het
Stab2	C	T	10: 86,901,567		probably null	Het
Timm22	T	C	11: 76,409,744	V114A	possibly damaging	Het
Timp4	A	G	6: 115,247,220	C163R	probably damaging	Het
Toporsl	T	A	4: 52,611,548	N480K	possibly damaging	Het
Tpo	T	C	12: 30,084,754	E735G	probably benign	Het
Ttn	T	C	2: 76,751,714	H22945R	probably damaging	Het
Vmn2r6	A	T	3: 64,547,380	Y499*	probably null	Het
Vwa1	G	A	4: 155,772,769	H191Y	probably benign	Het

Other mutations in Trpm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Trpm3	APN	19	22987659	missense	probably benign	0.00
IGL00773:Trpm3	APN	19	22900159	missense	possibly damaging	0.92
IGL00852:Trpm3	APN	19	22987071	missense	possibly damaging	0.93
IGL01597:Trpm3	APN	19	22715246	missense	probably damaging	1.00
IGL01607:Trpm3	APN	19	22987127	missense	probably benign	0.01
IGL01818:Trpm3	APN	19	22914474	missense	probably damaging	1.00
IGL01890:Trpm3	APN	19	22711719	missense	probably damaging	0.98
IGL02016:Trpm3	APN	19	22902069	nonsense	probably null
IGL02324:Trpm3	APN	19	22698779	missense	probably benign	0.25
IGL02947:Trpm3	APN	19	22901119	missense	probably damaging	0.99
IGL03037:Trpm3	APN	19	22889412	missense	possibly damaging	0.85
IGL03128:Trpm3	APN	19	22914465	missense	probably damaging	1.00
IGL03335:Trpm3	APN	19	22926071	critical splice donor site	probably null
IGL03354:Trpm3	APN	19	22856718	missense	probably damaging	1.00
bit	UTSW	19	22987869	missense	probably benign	0.00
G1patch:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
P0041:Trpm3	UTSW	19	22897686	missense	probably benign	0.01
R0001:Trpm3	UTSW	19	22715331	missense	possibly damaging	0.70
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0142:Trpm3	UTSW	19	22987916	missense	probably damaging	0.98
R0194:Trpm3	UTSW	19	22715356	splice site	probably null
R0268:Trpm3	UTSW	19	22897521	critical splice donor site	probably null
R0299:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0449:Trpm3	UTSW	19	22988054	missense	probably benign
R0481:Trpm3	UTSW	19	22901071	missense	possibly damaging	0.51
R0496:Trpm3	UTSW	19	22698778	missense	probably benign	0.00
R0499:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0550:Trpm3	UTSW	19	22987812	missense	probably damaging	0.97
R0729:Trpm3	UTSW	19	22987789	missense	probably benign
R0883:Trpm3	UTSW	19	22978654	missense	probably damaging	1.00
R0926:Trpm3	UTSW	19	22988043	missense	probably benign	0.02
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1513:Trpm3	UTSW	19	22986872	missense	possibly damaging	0.96
R1521:Trpm3	UTSW	19	22901221	missense	probably damaging	1.00
R1522:Trpm3	UTSW	19	22978334	missense	probably benign	0.39
R1569:Trpm3	UTSW	19	22889445	critical splice donor site	probably null
R1598:Trpm3	UTSW	19	22733024	missense	possibly damaging	0.47
R1600:Trpm3	UTSW	19	22139155	missense	probably benign	0.00
R1616:Trpm3	UTSW	19	22982712	missense	probably damaging	1.00
R1619:Trpm3	UTSW	19	22711907	missense	probably damaging	0.99
R1923:Trpm3	UTSW	19	22885412	missense	probably damaging	1.00
R1985:Trpm3	UTSW	19	22926082	missense	possibly damaging	0.56
R2002:Trpm3	UTSW	19	22982583	missense	probably damaging	1.00
R2249:Trpm3	UTSW	19	22733034	missense	probably benign	0.15
R3719:Trpm3	UTSW	19	22986990	missense	possibly damaging	0.95
R3766:Trpm3	UTSW	19	22448377	missense	probably benign
R3774:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3774:Trpm3	UTSW	19	22987975	missense	probably benign	0.03
R3776:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3820:Trpm3	UTSW	19	22987449	missense	probably benign	0.00
R3899:Trpm3	UTSW	19	22901160	missense	possibly damaging	0.90
R4204:Trpm3	UTSW	19	22987564	missense	probably benign	0.00
R4238:Trpm3	UTSW	19	22978638	missense	probably damaging	1.00
R4301:Trpm3	UTSW	19	22987292	missense	probably benign	0.23
R4344:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4345:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4365:Trpm3	UTSW	19	22978330	missense	probably benign	0.00
R4510:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4511:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4565:Trpm3	UTSW	19	22987869	missense	probably benign	0.00
R4573:Trpm3	UTSW	19	22902142	missense	probably damaging	1.00
R4606:Trpm3	UTSW	19	22978624	missense	probably benign	0.26
R4677:Trpm3	UTSW	19	22987388	missense	possibly damaging	0.95
R4684:Trpm3	UTSW	19	22987781	missense	probably benign
R4713:Trpm3	UTSW	19	22889435	missense	possibly damaging	0.83
R4745:Trpm3	UTSW	19	22715295	missense	possibly damaging	0.67
R5015:Trpm3	UTSW	19	22711712	missense	probably damaging	1.00
R5030:Trpm3	UTSW	19	22698766	missense	probably benign	0.01
R5074:Trpm3	UTSW	19	22885349	missense	possibly damaging	0.65
R5089:Trpm3	UTSW	19	22766756	missense	probably damaging	0.97
R5100:Trpm3	UTSW	19	22918766	missense	probably damaging	0.99
R5108:Trpm3	UTSW	19	22904714	missense	probably benign	0.06
R5204:Trpm3	UTSW	19	22448341	nonsense	probably null
R5213:Trpm3	UTSW	19	22697454	nonsense	probably null
R5358:Trpm3	UTSW	19	22925968	missense	probably damaging	1.00
R5374:Trpm3	UTSW	19	22926184	nonsense	probably null
R5382:Trpm3	UTSW	19	22885341	splice site	probably null
R5509:Trpm3	UTSW	19	22987258	missense	probably damaging	0.99
R5558:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R6154:Trpm3	UTSW	19	22987814	missense	probably damaging	1.00
R6250:Trpm3	UTSW	19	22910054	missense	probably benign	0.01
R6542:Trpm3	UTSW	19	22926113	missense	probably benign	0.04
R6630:Trpm3	UTSW	19	22987983	missense	probably benign	0.00
R6640:Trpm3	UTSW	19	22978582	missense	probably damaging	1.00
R6725:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
R7275:Trpm3	UTSW	19	22978684	missense	possibly damaging	0.71
R7371:Trpm3	UTSW	19	22902193	missense	probably benign	0.27
R7467:Trpm3	UTSW	19	22978334	missense	possibly damaging	0.82
R7488:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R7495:Trpm3	UTSW	19	22897796	missense	probably benign	0.28
R7600:Trpm3	UTSW	19	22926094	missense	possibly damaging	0.68
R7710:Trpm3	UTSW	19	22918790	missense	probably damaging	0.97
R7877:Trpm3	UTSW	19	22904784	missense	probably benign	0.25
R8184:Trpm3	UTSW	19	22918696	missense	possibly damaging	0.46
R8234:Trpm3	UTSW	19	22715276	missense	possibly damaging	0.47
R8236:Trpm3	UTSW	19	22987408	missense	probably benign	0.00
R8443:Trpm3	UTSW	19	22698862	missense	possibly damaging	0.90
R8470:Trpm3	UTSW	19	22910137	missense	possibly damaging	0.91
Z1176:Trpm3	UTSW	19	22987490	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CATCGACTTGGATGATCCTGAG -3'
(R):5'- AATGTCTCCACACCTCTAGGC -3'

Sequencing Primer
(F):5'- ATCCTGAGATCAACCACTTTCC -3'
(R):5'- ACACCTCTAGGCAGCACTGTG -3'

Posted On

2018-05-24