Incidental Mutation 'R6434:Olfr1134'
ID518675
Institutional Source Beutler Lab
Gene Symbol Olfr1134
Ensembl Gene ENSMUSG00000111747
Gene Name
SynonymsGA_x6K02T2Q125-49162076-49161138, MOR176-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87655673-87658460 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87656214 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 236 (K236*)
Ref Sequence ENSEMBL: ENSMUSP00000150358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099857] [ENSMUST00000135875] [ENSMUST00000213939]
Predicted Effect probably null
Transcript: ENSMUST00000099857
AA Change: K236*
SMART Domains Protein: ENSMUSP00000097443
Gene: ENSMUSG00000111747
AA Change: K236*

DomainStartEndE-ValueType
GHB 123 190 1.21e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135875
AA Change: K236*
Predicted Effect probably null
Transcript: ENSMUST00000213939
AA Change: K236*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Olfr1134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Olfr1134 APN 2 87656238 missense probably benign 0.01
IGL01397:Olfr1134 APN 2 87656905 missense probably damaging 0.99
IGL01583:Olfr1134 APN 2 87656413 nonsense probably null
IGL01655:Olfr1134 APN 2 87656429 missense probably damaging 1.00
IGL02184:Olfr1134 APN 2 87656792 missense probably damaging 0.99
IGL02263:Olfr1134 APN 2 87656199 missense probably damaging 1.00
IGL02964:Olfr1134 APN 2 87656714 missense probably damaging 1.00
IGL03391:Olfr1134 APN 2 87656688 missense possibly damaging 0.93
R5171:Olfr1134 UTSW 2 87656544 missense possibly damaging 0.95
R7466:Olfr1134 UTSW 2 87656396 missense possibly damaging 0.73
R7770:Olfr1134 UTSW 2 87656469 missense not run
Predicted Primers PCR Primer
(F):5'- ACCCAGGCCACAAGTTAATATTG -3'
(R):5'- GTGACATCCCACCCTTACTG -3'

Sequencing Primer
(F):5'- CAGGCCACAAGTTAATATTGATTGCC -3'
(R):5'- GGCCCTCTCCTGCTCAGATAC -3'
Posted On2018-05-24