Incidental Mutation 'R6434:Ect2'
ID518678
Institutional Source Beutler Lab
Gene Symbol Ect2
Ensembl Gene ENSMUSG00000027699
Gene Nameect2 oncogene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location27097222-27153878 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 27139119 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 269 (Y269*)
Ref Sequence ENSEMBL: ENSMUSP00000135740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108298] [ENSMUST00000108300] [ENSMUST00000176242] [ENSMUST00000184113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108296
Predicted Effect probably null
Transcript: ENSMUST00000108298
AA Change: Y269*
SMART Domains Protein: ENSMUSP00000103933
Gene: ENSMUSG00000027699
AA Change: Y269*

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108300
AA Change: Y300*
SMART Domains Protein: ENSMUSP00000103935
Gene: ENSMUSG00000027699
AA Change: Y300*

DomainStartEndE-ValueType
BRCT 174 250 1.45e-10 SMART
BRCT 268 344 2.52e-10 SMART
low complexity region 362 372 N/A INTRINSIC
RhoGEF 456 640 3.22e-67 SMART
Blast:PH 667 794 1e-80 BLAST
low complexity region 856 870 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124727
Predicted Effect probably null
Transcript: ENSMUST00000176242
AA Change: Y269*
SMART Domains Protein: ENSMUSP00000135740
Gene: ENSMUSG00000027699
AA Change: Y269*

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184113
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor and transforming protein that is related to Rho-specific exchange factors and yeast cell cycle regulators. The expression of this gene is elevated with the onset of DNA synthesis and remains elevated during G2 and M phases. In situ hybridization analysis showed that expression is at a high level in cells undergoing mitosis in regenerating liver. Thus, this protein is expressed in a cell cycle-dependent manner during liver regeneration, and is thought to have an important role in the regulation of cytokinesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Homozygous disruption of this locus is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Ect2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ect2 APN 3 27138669 missense probably benign 0.04
IGL00770:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL00774:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL01414:Ect2 APN 3 27127729 splice site probably benign
IGL02017:Ect2 APN 3 27122044 nonsense probably null
IGL02318:Ect2 APN 3 27138719 missense probably benign 0.16
IGL02395:Ect2 APN 3 27150106 missense probably damaging 1.00
IGL03109:Ect2 APN 3 27144972 missense possibly damaging 0.88
IGL03178:Ect2 APN 3 27148860 missense probably benign 0.03
IGL03055:Ect2 UTSW 3 27137062 missense probably damaging 1.00
PIT4504001:Ect2 UTSW 3 27126948 nonsense probably null
R0090:Ect2 UTSW 3 27115476 missense probably benign 0.00
R0090:Ect2 UTSW 3 27138502 missense probably null 0.08
R0436:Ect2 UTSW 3 27150095 missense probably benign 0.11
R0620:Ect2 UTSW 3 27139652 missense probably damaging 0.99
R1847:Ect2 UTSW 3 27150072 missense probably benign 0.01
R2404:Ect2 UTSW 3 27131850 missense probably benign 0.00
R3890:Ect2 UTSW 3 27138540 missense probably damaging 1.00
R3951:Ect2 UTSW 3 27130120 missense probably benign 0.00
R4588:Ect2 UTSW 3 27147000 missense probably damaging 1.00
R4754:Ect2 UTSW 3 27126963 missense probably damaging 1.00
R5051:Ect2 UTSW 3 27102486 missense probably benign
R5254:Ect2 UTSW 3 27130070 missense probably damaging 1.00
R5415:Ect2 UTSW 3 27146853 missense probably damaging 1.00
R5786:Ect2 UTSW 3 27146953 missense probably damaging 1.00
R5940:Ect2 UTSW 3 27115465 missense probably benign 0.01
R5974:Ect2 UTSW 3 27144963 nonsense probably null
R6012:Ect2 UTSW 3 27098325 utr 3 prime probably benign
R6447:Ect2 UTSW 3 27115484 missense probably damaging 1.00
R6850:Ect2 UTSW 3 27138885 missense probably damaging 1.00
R6989:Ect2 UTSW 3 27102488 nonsense probably null
R7147:Ect2 UTSW 3 27150090 missense probably benign 0.12
R7257:Ect2 UTSW 3 27138535 missense probably damaging 1.00
R7417:Ect2 UTSW 3 27098419 missense probably damaging 1.00
R7564:Ect2 UTSW 3 27116123 intron probably benign
R7662:Ect2 UTSW 3 27131798 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGAATGCTTCCCCAGAACC -3'
(R):5'- TCAGGTAACATGATGTCTGTGG -3'

Sequencing Primer
(F):5'- TGCTTCCCCAGAACCACTAAAAGAG -3'
(R):5'- TTAGTGGACGTAGAAGACCCATTC -3'
Posted On2018-05-24