Incidental Mutation 'R6434:Ifi44'
ID518683
Institutional Source Beutler Lab
Gene Symbol Ifi44
Ensembl Gene ENSMUSG00000028037
Gene Nameinterferon-induced protein 44
SynonymsA430056A10Rik, p44, MTAP44
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location151730922-151749960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 151749189 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 133 (N133I)
Ref Sequence ENSEMBL: ENSMUSP00000029671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029671]
Predicted Effect probably benign
Transcript: ENSMUST00000029671
AA Change: N133I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029671
Gene: ENSMUSG00000028037
AA Change: N133I

DomainStartEndE-ValueType
Pfam:TLD 26 147 2.8e-7 PFAM
low complexity region 193 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149919
Meta Mutation Damage Score 0.1097 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Ifi44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ifi44 APN 3 151749580 missense probably benign 0.03
IGL01477:Ifi44 APN 3 151745998 splice site probably benign
IGL01571:Ifi44 APN 3 151745537 missense probably damaging 0.97
IGL02165:Ifi44 APN 3 151749430 missense probably damaging 1.00
IGL02238:Ifi44 APN 3 151732382 makesense probably null
IGL02609:Ifi44 APN 3 151732497 missense probably damaging 1.00
IGL02650:Ifi44 APN 3 151745855 missense probably damaging 1.00
IGL02726:Ifi44 APN 3 151749596 start gained probably benign
IGL02977:Ifi44 APN 3 151739379 missense probably benign 0.00
R0201:Ifi44 UTSW 3 151745636 missense probably damaging 1.00
R0454:Ifi44 UTSW 3 151745497 missense possibly damaging 0.78
R0763:Ifi44 UTSW 3 151749498 missense probably damaging 1.00
R1640:Ifi44 UTSW 3 151732534 missense probably benign 0.00
R1747:Ifi44 UTSW 3 151749285 missense probably benign 0.00
R2278:Ifi44 UTSW 3 151732388 missense probably benign
R3816:Ifi44 UTSW 3 151749257 missense possibly damaging 0.92
R4075:Ifi44 UTSW 3 151745976 missense probably benign 0.00
R4084:Ifi44 UTSW 3 151745489 critical splice donor site probably null
R4782:Ifi44 UTSW 3 151745592 missense probably damaging 0.99
R5071:Ifi44 UTSW 3 151749632 start gained probably benign
R5074:Ifi44 UTSW 3 151749632 start gained probably benign
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6128:Ifi44 UTSW 3 151749186 missense probably benign 0.00
R6192:Ifi44 UTSW 3 151745639 critical splice acceptor site probably null
R6536:Ifi44 UTSW 3 151732489 missense probably benign 0.03
R6902:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R6946:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R7346:Ifi44 UTSW 3 151732457 missense probably benign
R7608:Ifi44 UTSW 3 151732408 missense probably damaging 0.97
R7704:Ifi44 UTSW 3 151732424 missense probably benign 0.44
R8255:Ifi44 UTSW 3 151745982 missense probably benign 0.00
Z1176:Ifi44 UTSW 3 151732453 missense probably damaging 1.00
Z1177:Ifi44 UTSW 3 151749438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGTCATCTCTCCAGACTTG -3'
(R):5'- TGTGTTATTGGCATGTACCTGAAAG -3'

Sequencing Primer
(F):5'- TCCAGACTTGAGAGCCTGAGTTTAAG -3'
(R):5'- GCTTCCAGGGAAAAGATGTTTC -3'
Posted On2018-05-24