Incidental Mutation 'R6434:Dnajc11'
ID518687
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene NameDnaJ heat shock protein family (Hsp40) member C11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location151933691-151982137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151979294 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 449 (V449A)
Ref Sequence ENSEMBL: ENSMUSP00000051643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036680] [ENSMUST00000062904] [ENSMUST00000105665] [ENSMUST00000139069]
Predicted Effect probably benign
Transcript: ENSMUST00000036680
SMART Domains Protein: ENSMUSP00000035240
Gene: ENSMUSG00000039759

DomainStartEndE-ValueType
THAP 3 88 5.28e-19 SMART
DM3 23 87 6.96e-21 SMART
coiled coil region 166 189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062904
AA Change: V449A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: V449A

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105665
SMART Domains Protein: ENSMUSP00000101290
Gene: ENSMUSG00000039759

DomainStartEndE-ValueType
THAP 3 88 5.28e-19 SMART
DM3 23 87 6.96e-21 SMART
coiled coil region 132 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128582
Predicted Effect probably benign
Transcript: ENSMUST00000139069
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149337
Meta Mutation Damage Score 0.2753 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 151979302 missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 151950519 nonsense probably null
IGL02606:Dnajc11 APN 4 151979484 missense probably benign 0.18
IGL02969:Dnajc11 APN 4 151978046 missense probably benign 0.33
IGL03062:Dnajc11 APN 4 151970861 missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 151952889 missense probably benign 0.04
R0601:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 151973628 missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 151979273 missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 151978093 unclassified probably benign
R4545:Dnajc11 UTSW 4 151979941 missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 151973617 missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 151968539 missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 151970967 unclassified probably benign
R4751:Dnajc11 UTSW 4 151968542 missense probably benign 0.01
R4895:Dnajc11 UTSW 4 151979933 missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 151976997 missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 151969814 unclassified probably benign
R5174:Dnajc11 UTSW 4 151979984 missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 151969939 missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 151968526 missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 151979510 missense probably benign
R6056:Dnajc11 UTSW 4 151978126 unclassified probably benign
R7635:Dnajc11 UTSW 4 151968611 missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 151974225 missense probably damaging 0.99
R8093:Dnajc11 UTSW 4 151969900 missense probably damaging 1.00
Z1176:Dnajc11 UTSW 4 151933783 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGTACTGTCCCTTCCACTGC -3'
(R):5'- GCATTCACGATGATAAGCCC -3'

Sequencing Primer
(F):5'- AGGTGACTCCCCAACAGG -3'
(R):5'- TTCACGATGATAAGCCCTGGGG -3'
Posted On2018-05-24