Incidental Mutation 'R6434:Ccdc96'
ID518689
Institutional Source Beutler Lab
Gene Symbol Ccdc96
Ensembl Gene ENSMUSG00000050677
Gene Namecoiled-coil domain containing 96
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location36484588-36488172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 36486363 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 571 (V571G)
Ref Sequence ENSEMBL: ENSMUSP00000059636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031094] [ENSMUST00000031097] [ENSMUST00000060100] [ENSMUST00000119916] [ENSMUST00000126077] [ENSMUST00000136189] [ENSMUST00000140607] [ENSMUST00000146430] [ENSMUST00000171385]
Predicted Effect probably benign
Transcript: ENSMUST00000031094
SMART Domains Protein: ENSMUSP00000031094
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031097
SMART Domains Protein: ENSMUSP00000031097
Gene: ENSMUSG00000029196

DomainStartEndE-ValueType
ZnF_ZZ 3 46 2.64e-5 SMART
SANT 66 116 1.75e-9 SMART
low complexity region 138 154 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060100
AA Change: V571G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059636
Gene: ENSMUSG00000050677
AA Change: V571G

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
SCOP:d1qbkb_ 99 144 6e-3 SMART
low complexity region 223 234 N/A INTRINSIC
coiled coil region 315 355 N/A INTRINSIC
Pfam:DUF4201 394 570 9.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119916
SMART Domains Protein: ENSMUSP00000114124
Gene: ENSMUSG00000029196

DomainStartEndE-ValueType
Blast:SANT 16 41 2e-10 BLAST
low complexity region 63 79 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 231 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126077
SMART Domains Protein: ENSMUSP00000114508
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136189
SMART Domains Protein: ENSMUSP00000115467
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 247 322 1e-32 BLAST
TBC 399 559 8.9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140607
SMART Domains Protein: ENSMUSP00000121516
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146430
SMART Domains Protein: ENSMUSP00000121816
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171385
SMART Domains Protein: ENSMUSP00000131876
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Meta Mutation Damage Score 0.4068 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Ccdc96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ccdc96 APN 5 36485080 unclassified probably benign
R0167:Ccdc96 UTSW 5 36485153 missense probably benign 0.18
R0302:Ccdc96 UTSW 5 36486101 missense possibly damaging 0.51
R0423:Ccdc96 UTSW 5 36485247 missense probably benign 0.41
R0532:Ccdc96 UTSW 5 36486366 missense probably benign 0.18
R3800:Ccdc96 UTSW 5 36486267 missense probably damaging 1.00
R3977:Ccdc96 UTSW 5 36485166 missense possibly damaging 0.96
R4575:Ccdc96 UTSW 5 36486075 missense possibly damaging 0.88
R4720:Ccdc96 UTSW 5 36484875 unclassified probably benign
R5476:Ccdc96 UTSW 5 36485637 missense possibly damaging 0.83
R5945:Ccdc96 UTSW 5 36485850 missense probably damaging 1.00
R5995:Ccdc96 UTSW 5 36486374 missense probably damaging 0.99
R6493:Ccdc96 UTSW 5 36486252 missense probably damaging 0.99
R6632:Ccdc96 UTSW 5 36485189 missense probably benign 0.07
R6633:Ccdc96 UTSW 5 36485189 missense probably benign 0.07
R7395:Ccdc96 UTSW 5 36485265 missense probably benign 0.29
R7819:Ccdc96 UTSW 5 36485985 missense probably damaging 0.98
X0022:Ccdc96 UTSW 5 36486374 missense probably damaging 1.00
Z1176:Ccdc96 UTSW 5 36485594 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTAGGAAGAGACCTGTTGACG -3'
(R):5'- CTAGCTGGAAGTGTTCAGCAG -3'

Sequencing Primer
(F):5'- GACCTGTTGACGAAGACAAAAC -3'
(R):5'- TGTTCAGCAGGAATTTGAAAGCTG -3'
Posted On2018-05-24