Incidental Mutation 'R6434:Slco1c1'
ID518694
Institutional Source Beutler Lab
Gene Symbol Slco1c1
Ensembl Gene ENSMUSG00000030235
Gene Namesolute carrier organic anion transporter family, member 1c1
SynonymsSlc21a14, OATP-F
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location141524368-141570177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141547850 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 371 (S371P)
Ref Sequence ENSEMBL: ENSMUSP00000138093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032362] [ENSMUST00000135562] [ENSMUST00000203140] [ENSMUST00000204998] [ENSMUST00000205214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032362
AA Change: S371P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032362
Gene: ENSMUSG00000030235
AA Change: S371P

DomainStartEndE-ValueType
low complexity region 134 148 N/A INTRINSIC
low complexity region 152 168 N/A INTRINSIC
Pfam:MFS_1 181 464 1.1e-19 PFAM
KAZAL 478 518 1.21e0 SMART
transmembrane domain 644 666 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135562
AA Change: S371P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138093
Gene: ENSMUSG00000030235
AA Change: S371P

DomainStartEndE-ValueType
Pfam:OATP 42 469 2.1e-135 PFAM
Pfam:Sugar_tr 175 460 2.9e-7 PFAM
Pfam:MFS_1 181 463 3.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203140
AA Change: S253P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145058
Gene: ENSMUSG00000030235
AA Change: S253P

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
Pfam:MFS_1 63 346 2e-18 PFAM
KAZAL 360 400 7.8e-3 SMART
transmembrane domain 437 459 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203755
Predicted Effect probably benign
Transcript: ENSMUST00000204998
Predicted Effect probably damaging
Transcript: ENSMUST00000205214
AA Change: S322P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144889
Gene: ENSMUSG00000030235
AA Change: S322P

DomainStartEndE-ValueType
Pfam:OATP 44 176 1.3e-35 PFAM
Pfam:MFS_1 169 415 1.1e-10 PFAM
KAZAL 429 469 7.8e-3 SMART
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of thyroid hormones in brain tissues. This protein has particularly high affinity for the thyroid hormones thyroxine, tri-iodothyronine and reverse tri-iodothyronine. Polymorphisms in the gene encoding this protein may be associated with fatigue and depression in patients suffering from hyperthyroidism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thyroxine and triiodothyronine levels in the forebrain, in the absence of overt growth, reproductive or neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Slco1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Slco1c1 APN 6 141569482 missense probably benign 0.00
IGL00766:Slco1c1 APN 6 141547883 missense probably damaging 1.00
IGL00825:Slco1c1 APN 6 141542142 missense probably damaging 1.00
IGL01380:Slco1c1 APN 6 141540051 missense probably damaging 1.00
IGL01583:Slco1c1 APN 6 141540067 missense probably damaging 1.00
IGL01877:Slco1c1 APN 6 141555153 missense probably damaging 0.98
IGL02601:Slco1c1 APN 6 141544829 missense probably damaging 1.00
IGL02852:Slco1c1 APN 6 141547824 nonsense probably null
IGL03058:Slco1c1 APN 6 141563187 missense probably benign 0.44
IGL03102:Slco1c1 APN 6 141544827 missense possibly damaging 0.63
R0101:Slco1c1 UTSW 6 141531510 missense probably damaging 0.99
R0326:Slco1c1 UTSW 6 141559773 missense probably benign 0.45
R0755:Slco1c1 UTSW 6 141531532 missense probably damaging 0.99
R1335:Slco1c1 UTSW 6 141542127 missense probably damaging 1.00
R2011:Slco1c1 UTSW 6 141555107 missense probably benign 0.00
R2084:Slco1c1 UTSW 6 141559852 nonsense probably null
R2163:Slco1c1 UTSW 6 141559752 missense probably benign 0.25
R2190:Slco1c1 UTSW 6 141563167 missense probably benign 0.02
R2248:Slco1c1 UTSW 6 141546689 missense probably damaging 1.00
R2876:Slco1c1 UTSW 6 141559856 missense probably damaging 1.00
R3004:Slco1c1 UTSW 6 141532654 missense probably damaging 1.00
R3196:Slco1c1 UTSW 6 141531448 splice site probably null
R4444:Slco1c1 UTSW 6 141546691 missense possibly damaging 0.96
R4529:Slco1c1 UTSW 6 141555181 missense probably damaging 1.00
R4743:Slco1c1 UTSW 6 141564516 missense probably damaging 0.98
R5261:Slco1c1 UTSW 6 141546776 missense probably damaging 1.00
R5451:Slco1c1 UTSW 6 141559878 missense probably benign 0.04
R5558:Slco1c1 UTSW 6 141567496 missense probably damaging 0.97
R5813:Slco1c1 UTSW 6 141542203 missense probably damaging 1.00
R5836:Slco1c1 UTSW 6 141569314 missense probably damaging 1.00
R6084:Slco1c1 UTSW 6 141546770 missense probably benign 0.02
R6544:Slco1c1 UTSW 6 141531444 unclassified probably null
R6766:Slco1c1 UTSW 6 141547809 missense possibly damaging 0.49
R6865:Slco1c1 UTSW 6 141540052 missense probably damaging 1.00
R7050:Slco1c1 UTSW 6 141547926 missense probably damaging 1.00
R7164:Slco1c1 UTSW 6 141542129 nonsense probably null
R7255:Slco1c1 UTSW 6 141569325 missense probably benign 0.07
R7362:Slco1c1 UTSW 6 141569463 missense probably benign 0.00
R7696:Slco1c1 UTSW 6 141567610 missense probably benign 0.01
R8316:Slco1c1 UTSW 6 141546914 missense probably benign 0.03
X0061:Slco1c1 UTSW 6 141532739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATGCCTAGATTCAAGCC -3'
(R):5'- CCCACCATGTATATATTCATGCTAC -3'

Sequencing Primer
(F):5'- TGCCTAGATTCAAGCCCAGGC -3'
(R):5'- CAGAAAGGTGGACATACCAA -3'
Posted On2018-05-24