Incidental Mutation 'R6434:Zfp719'
ID518695
Institutional Source Beutler Lab
Gene Symbol Zfp719
Ensembl Gene ENSMUSG00000030469
Gene Namezinc finger protein 719
Synonyms9430094P17Rik, mszf6, C630016O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43579610-43593235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43590988 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 667 (H667N)
Ref Sequence ENSEMBL: ENSMUSP00000050968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058104] [ENSMUST00000205769]
Predicted Effect probably damaging
Transcript: ENSMUST00000058104
AA Change: H667N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050968
Gene: ENSMUSG00000030469
AA Change: H667N

DomainStartEndE-ValueType
KRAB 49 109 1.18e-20 SMART
ZnF_C2H2 285 305 4.16e1 SMART
ZnF_C2H2 341 363 1.2e-3 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
ZnF_C2H2 397 419 6.67e-2 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 3.34e-2 SMART
ZnF_C2H2 481 503 1.38e-3 SMART
ZnF_C2H2 509 531 5.42e-2 SMART
ZnF_C2H2 537 559 3.78e-1 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 4.54e-4 SMART
ZnF_C2H2 621 643 4.24e-4 SMART
ZnF_C2H2 649 671 6.42e-4 SMART
ZnF_C2H2 677 699 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205769
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Other mutations in Zfp719
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Zfp719 APN 7 43591130 missense probably damaging 1.00
IGL01407:Zfp719 APN 7 43584187 missense probably benign 0.00
IGL01763:Zfp719 APN 7 43584189 missense probably benign 0.00
IGL03079:Zfp719 APN 7 43591166 missense probably damaging 1.00
R0522:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0524:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0542:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0543:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0662:Zfp719 UTSW 7 43584254 missense possibly damaging 0.56
R1390:Zfp719 UTSW 7 43590443 missense possibly damaging 0.69
R2959:Zfp719 UTSW 7 43590427 missense possibly damaging 0.89
R4708:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4709:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4710:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4716:Zfp719 UTSW 7 43591111 missense possibly damaging 0.80
R4729:Zfp719 UTSW 7 43590410 missense probably damaging 1.00
R4755:Zfp719 UTSW 7 43590793 missense probably damaging 1.00
R5176:Zfp719 UTSW 7 43591125 missense probably damaging 1.00
R5949:Zfp719 UTSW 7 43584117 intron probably benign
R6063:Zfp719 UTSW 7 43589626 nonsense probably null
R6363:Zfp719 UTSW 7 43589866 missense probably benign 0.03
R6465:Zfp719 UTSW 7 43590684 nonsense probably null
R6806:Zfp719 UTSW 7 43586385 missense possibly damaging 0.63
R6925:Zfp719 UTSW 7 43590706 missense probably damaging 1.00
R8124:Zfp719 UTSW 7 43589890 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACTGTGGAATGGCCTTCAG -3'
(R):5'- CATGGATGTCACTTGTGAATTCTG -3'

Sequencing Primer
(F):5'- ACTGTCGATTTCACACAGGG -3'
(R):5'- CTTGTGAATTCTGCAGGAAACCC -3'
Posted On2018-05-24