Incidental Mutation 'R6434:Aspdh'
ID518696
Institutional Source Beutler Lab
Gene Symbol Aspdh
Ensembl Gene ENSMUSG00000038704
Gene Nameaspartate dehydrogenase domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44465391-44467758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44467050 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 86 (A86T)
Ref Sequence ENSEMBL: ENSMUSP00000121766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035844] [ENSMUST00000035929] [ENSMUST00000058667] [ENSMUST00000117324] [ENSMUST00000118493] [ENSMUST00000118628] [ENSMUST00000120852] [ENSMUST00000121922] [ENSMUST00000134398] [ENSMUST00000135624] [ENSMUST00000136609] [ENSMUST00000136679] [ENSMUST00000146128] [ENSMUST00000152902] [ENSMUST00000156957] [ENSMUST00000206887] [ENSMUST00000208117]
Predicted Effect probably benign
Transcript: ENSMUST00000035844
SMART Domains Protein: ENSMUSP00000048415
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000035929
AA Change: A204T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704
AA Change: A204T

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058667
SMART Domains Protein: ENSMUSP00000053123
Gene: ENSMUSG00000047085

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
LRR 208 229 1.62e2 SMART
LRR_TYP 230 253 3.63e-3 SMART
LRR 254 277 9.75e0 SMART
LRR_TYP 278 301 5.29e-5 SMART
LRRCT 313 364 1.92e-3 SMART
IGc2 378 445 1.45e-9 SMART
low complexity region 462 482 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 624 644 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117324
SMART Domains Protein: ENSMUSP00000113313
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118493
SMART Domains Protein: ENSMUSP00000113226
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118628
SMART Domains Protein: ENSMUSP00000113172
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120852
SMART Domains Protein: ENSMUSP00000114105
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121922
SMART Domains Protein: ENSMUSP00000112796
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 134 7e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000134398
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000136609
SMART Domains Protein: ENSMUSP00000123205
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 97 7.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136679
SMART Domains Protein: ENSMUSP00000114900
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Pfam:Josephin 18 61 3.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139097
Predicted Effect probably damaging
Transcript: ENSMUST00000146128
AA Change: A186T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704
AA Change: A186T

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149341
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155659
Predicted Effect probably damaging
Transcript: ENSMUST00000156957
AA Change: A86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121766
Gene: ENSMUSG00000038704
AA Change: A86T

DomainStartEndE-ValueType
Pfam:DUF108 52 151 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206210
Predicted Effect probably benign
Transcript: ENSMUST00000206887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207591
Predicted Effect probably benign
Transcript: ENSMUST00000208117
Meta Mutation Damage Score 0.3974 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Aspdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Aspdh APN 7 44466559 splice site probably null
IGL02967:Aspdh APN 7 44465539 unclassified probably null
R3854:Aspdh UTSW 7 44466189 missense possibly damaging 0.93
R4751:Aspdh UTSW 7 44467205 nonsense probably null
Z1177:Aspdh UTSW 7 44465530 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCCAGAGCCTTCGAGTCAC -3'
(R):5'- TGTAACAGTAGCAGAGCCGG -3'

Sequencing Primer
(F):5'- AGAGCCTTCGAGTCACCATGG -3'
(R):5'- TGTGCACGGCAAAGCTG -3'
Posted On2018-05-24