Incidental Mutation 'R6434:Fan1'
ID518697
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene NameFANCD2/FANCI-associated nuclease 1
SynonymsMtmr15
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64346758-64374095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64354381 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 779 (D779V)
Ref Sequence ENSEMBL: ENSMUSP00000130012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163289]
Predicted Effect probably damaging
Transcript: ENSMUST00000163289
AA Change: D779V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458
AA Change: D779V

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Meta Mutation Damage Score 0.2691 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64372549 missense probably damaging 0.96
IGL01752:Fan1 APN 7 64372794 missense probably benign 0.00
IGL01971:Fan1 APN 7 64353711 missense probably damaging 0.98
IGL02043:Fan1 APN 7 64371619 unclassified probably null
IGL02542:Fan1 APN 7 64364660 missense probably damaging 1.00
IGL02731:Fan1 APN 7 64372993 missense possibly damaging 0.86
IGL03111:Fan1 APN 7 64350068 missense possibly damaging 0.67
hitched UTSW 7 64364629 missense probably damaging 1.00
stitched UTSW 7 64372486 missense probably damaging 0.97
R0270:Fan1 UTSW 7 64348871 missense probably benign 0.26
R0632:Fan1 UTSW 7 64363199 missense possibly damaging 0.50
R1714:Fan1 UTSW 7 64366687 missense probably benign 0.29
R1750:Fan1 UTSW 7 64373013 missense probably benign 0.14
R1822:Fan1 UTSW 7 64372806 missense probably benign 0.00
R2031:Fan1 UTSW 7 64354424 missense probably damaging 0.98
R2107:Fan1 UTSW 7 64366788 missense probably damaging 1.00
R2126:Fan1 UTSW 7 64346888 missense probably damaging 1.00
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2873:Fan1 UTSW 7 64363190 missense probably benign 0.16
R3849:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3850:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3949:Fan1 UTSW 7 64371544 nonsense probably null
R4007:Fan1 UTSW 7 64366561 missense probably damaging 1.00
R4490:Fan1 UTSW 7 64369180 missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64373553 nonsense probably null
R4918:Fan1 UTSW 7 64373538 utr 5 prime probably benign
R5328:Fan1 UTSW 7 64354469 missense probably damaging 1.00
R5691:Fan1 UTSW 7 64354370 unclassified probably null
R5902:Fan1 UTSW 7 64373322 unclassified probably null
R5905:Fan1 UTSW 7 64353651 missense probably benign 0.00
R6126:Fan1 UTSW 7 64364570 nonsense probably null
R6195:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6233:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6405:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6469:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6471:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6473:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6696:Fan1 UTSW 7 64350078 missense probably damaging 1.00
R6708:Fan1 UTSW 7 64372806 missense probably benign 0.00
R6713:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6714:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6749:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6841:Fan1 UTSW 7 64364629 missense probably damaging 1.00
R6858:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6859:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6860:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6925:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6927:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6936:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6938:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6939:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7040:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7120:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7290:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7292:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7459:Fan1 UTSW 7 64348966 missense probably damaging 0.99
R7460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7464:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7465:Fan1 UTSW 7 64353638 missense probably benign 0.30
R7465:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7608:Fan1 UTSW 7 64354231 intron probably null
R7624:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7629:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7682:Fan1 UTSW 7 64372764 missense probably benign 0.06
R7731:Fan1 UTSW 7 64372696 missense probably benign 0.17
R7863:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8054:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8055:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8057:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8058:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8101:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8241:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8262:Fan1 UTSW 7 64373306 missense probably benign 0.02
R8274:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8275:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8276:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8285:Fan1 UTSW 7 64366600 missense probably damaging 0.96
R8318:Fan1 UTSW 7 64350055 missense probably damaging 1.00
X0025:Fan1 UTSW 7 64372835 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGACCATTCTGAGTCCAAGATG -3'
(R):5'- CAAAGTAAATTGACAGCTGCTGC -3'

Sequencing Primer
(F):5'- CCAAGATGGAGTTACATACTAAAAGG -3'
(R):5'- ATGTTGACATGTGACTTGTTAATTGC -3'
Posted On2018-05-24