Incidental Mutation 'R6434:Ccdc130'
ID518699
Institutional Source Beutler Lab
Gene Symbol Ccdc130
Ensembl Gene ENSMUSG00000004994
Gene Namecoiled-coil domain containing 130
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84257795-84270380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84263001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 63 (I63T)
Ref Sequence ENSEMBL: ENSMUSP00000096177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005120] [ENSMUST00000098578] [ENSMUST00000163993] [ENSMUST00000172320]
Predicted Effect probably damaging
Transcript: ENSMUST00000005120
AA Change: I63T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005120
Gene: ENSMUSG00000004994
AA Change: I63T

DomainStartEndE-ValueType
Pfam:DUF572 1 198 1.7e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098578
AA Change: I63T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096177
Gene: ENSMUSG00000004994
AA Change: I63T

DomainStartEndE-ValueType
Pfam:DUF572 1 384 1.4e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166728
Predicted Effect probably damaging
Transcript: ENSMUST00000172320
AA Change: I63T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128605
Gene: ENSMUSG00000004994
AA Change: I63T

DomainStartEndE-ValueType
Pfam:DUF572 1 68 1.4e-31 PFAM
Meta Mutation Damage Score 0.8607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Ccdc130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Ccdc130 APN 8 84260534 splice site probably benign
IGL02536:Ccdc130 APN 8 84260616 nonsense probably null
IGL02810:Ccdc130 APN 8 84264368 splice site probably benign
R0350:Ccdc130 UTSW 8 84260648 missense probably damaging 1.00
R0567:Ccdc130 UTSW 8 84260665 missense probably damaging 1.00
R1807:Ccdc130 UTSW 8 84260307 missense probably damaging 1.00
R2209:Ccdc130 UTSW 8 84263869 missense probably benign 0.00
R3933:Ccdc130 UTSW 8 84260352 missense probably benign 0.08
R3949:Ccdc130 UTSW 8 84258824 missense probably benign 0.03
R4633:Ccdc130 UTSW 8 84260395 missense probably benign 0.06
R4715:Ccdc130 UTSW 8 84263874 missense probably damaging 1.00
R4722:Ccdc130 UTSW 8 84258810 missense probably benign 0.00
R5001:Ccdc130 UTSW 8 84258675 missense probably benign 0.10
R5631:Ccdc130 UTSW 8 84263881 missense probably damaging 0.99
R5874:Ccdc130 UTSW 8 84258548 missense possibly damaging 0.92
R6467:Ccdc130 UTSW 8 84258689 missense probably benign
R7259:Ccdc130 UTSW 8 84260317 missense probably damaging 1.00
R7822:Ccdc130 UTSW 8 84261782 missense probably damaging 1.00
Z1088:Ccdc130 UTSW 8 84258909 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAACATCTCCAGTGTCTC -3'
(R):5'- AGAGTTCATGAACAGCCAGAATAC -3'

Sequencing Primer
(F):5'- CAGTGTCTCATAGTACTTGGCACAG -3'
(R):5'- TGTTGCCAAGCCAGAGATC -3'
Posted On2018-05-24