Incidental Mutation 'R6434:Vps35'
ID518700
Institutional Source Beutler Lab
Gene Symbol Vps35
Ensembl Gene ENSMUSG00000031696
Gene NameVPS35 retromer complex component
SynonymsMem3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85260392-85299802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85273495 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 501 (D501N)
Ref Sequence ENSEMBL: ENSMUSP00000034131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034131]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034131
AA Change: D501N

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696
AA Change: D501N

DomainStartEndE-ValueType
Pfam:Vps35 15 753 6.8e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209277
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Vps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Vps35 APN 8 85273463 splice site probably benign
IGL02604:Vps35 APN 8 85286389 missense probably damaging 1.00
IGL03278:Vps35 APN 8 85294961 unclassified probably benign
IGL03326:Vps35 APN 8 85274897 nonsense probably null
PIT4151001:Vps35 UTSW 8 85284048 missense possibly damaging 0.95
R0118:Vps35 UTSW 8 85294953 missense probably benign 0.04
R0226:Vps35 UTSW 8 85273575 missense probably damaging 0.97
R1079:Vps35 UTSW 8 85279054 missense probably damaging 1.00
R1477:Vps35 UTSW 8 85287800 missense probably damaging 1.00
R1969:Vps35 UTSW 8 85278994 missense possibly damaging 0.90
R2082:Vps35 UTSW 8 85263465 missense possibly damaging 0.95
R2156:Vps35 UTSW 8 85286500 missense probably benign 0.06
R2341:Vps35 UTSW 8 85274814 splice site probably benign
R3752:Vps35 UTSW 8 85274831 missense probably benign 0.34
R4589:Vps35 UTSW 8 85287702 missense probably damaging 1.00
R4745:Vps35 UTSW 8 85261262 missense probably benign
R4790:Vps35 UTSW 8 85278857 splice site probably null
R4827:Vps35 UTSW 8 85273557 missense possibly damaging 0.94
R4953:Vps35 UTSW 8 85281846 missense probably damaging 1.00
R6277:Vps35 UTSW 8 85261228 missense possibly damaging 0.80
R6291:Vps35 UTSW 8 85299457 start codon destroyed probably benign 0.07
R7175:Vps35 UTSW 8 85263560 splice site probably null
R7206:Vps35 UTSW 8 85287721 missense probably damaging 1.00
R7309:Vps35 UTSW 8 85274967 missense probably benign 0.05
R7479:Vps35 UTSW 8 85270805 missense probably benign 0.17
R7547:Vps35 UTSW 8 85263370 missense probably damaging 1.00
R7761:Vps35 UTSW 8 85284078 missense possibly damaging 0.91
R7812:Vps35 UTSW 8 85284189 missense probably benign 0.01
R8312:Vps35 UTSW 8 85274869 missense possibly damaging 0.65
X0020:Vps35 UTSW 8 85263421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTTCTTCATGAGTGCCAAC -3'
(R):5'- GTATCCACTTAGAAACTGTTGCC -3'

Sequencing Primer
(F):5'- ATGGCTACAGTGAGAACTTGCCTC -3'
(R):5'- ATTCAGGATCAGCCAGAC -3'
Posted On2018-05-24