Incidental Mutation 'R6434:Mtmr4'
ID518713
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Namemyotubularin related protein 4
SynonymsZFYVE11, FYVE zinc finger phosphatase, ESTM44, FYVE-DSP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87592162-87616302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87613483 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1086 (D1086G)
Ref Sequence ENSEMBL: ENSMUSP00000112902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000093956] [ENSMUST00000103179] [ENSMUST00000119628]
Predicted Effect probably damaging
Transcript: ENSMUST00000092802
AA Change: D1029G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: D1029G

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093956
SMART Domains Protein: ENSMUSP00000091488
Gene: ENSMUSG00000070345

DomainStartEndE-ValueType
HSF 11 153 2.35e-9 SMART
Blast:HSF 163 423 1e-149 BLAST
low complexity region 442 457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103179
AA Change: D1086G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: D1086G

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119628
AA Change: D1086G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: D1086G

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87611924 missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87604067 missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87602404 unclassified probably benign
IGL01544:Mtmr4 APN 11 87597611 splice site probably benign
IGL01574:Mtmr4 APN 11 87600647 missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87604150 missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87601124 missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87614234 missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87600783 missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87597693 missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87612003 missense possibly damaging 0.63
Hippie UTSW 11 87613483 missense probably damaging 1.00
incharge UTSW 11 87611042 nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87611127 missense probably benign
R0009:Mtmr4 UTSW 11 87611508 missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87598888 missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87611064 missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87611440 missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87612225 missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87613516 missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87602830 missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87612117 missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87605090 missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87610967 missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87600823 missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87604997 missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87604097 missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87611042 nonsense probably null
R5502:Mtmr4 UTSW 11 87614078 missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87604530 missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87605049 nonsense probably null
R5907:Mtmr4 UTSW 11 87612050 missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87604151 missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87611019 missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87613527 missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87600613 missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87604605 critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87611237 missense probably benign
R7350:Mtmr4 UTSW 11 87600650 missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87604557 missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87611901 missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87611876 missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87604580 missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87597724 missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87612189 missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87598864 missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87611825 missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87611880 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GCTTCATAGTATTCAGGTGATGC -3'
(R):5'- TTGGTGACTACTTGCCTAAAAGG -3'

Sequencing Primer
(F):5'- AGACAACTATTGTGTGGCCC -3'
(R):5'- GCCTAAAAGGATAGTACTTATCTGGG -3'
Posted On2018-05-24