Incidental Mutation 'R6434:Auh'
ID518721
Institutional Source Beutler Lab
Gene Symbol Auh
Ensembl Gene ENSMUSG00000021460
Gene NameAU RNA binding protein/enoyl-coenzyme A hydratase
SynonymsW91705
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6434 (G1)
Quality Score99.0078
Status Validated
Chromosome13
Chromosomal Location52835119-52929681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52929410 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 17 (G17C)
Ref Sequence ENSEMBL: ENSMUSP00000116179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021913] [ENSMUST00000110031] [ENSMUST00000119311] [ENSMUST00000120535] [ENSMUST00000123599]
Predicted Effect probably benign
Transcript: ENSMUST00000021913
SMART Domains Protein: ENSMUSP00000021913
Gene: ENSMUSG00000021460

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 314 4.5e-62 PFAM
Pfam:ECH_2 64 248 1.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110031
SMART Domains Protein: ENSMUSP00000105658
Gene: ENSMUSG00000021460

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH 57 120 5.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119311
SMART Domains Protein: ENSMUSP00000113659
Gene: ENSMUSG00000021460

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 115 2.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120535
SMART Domains Protein: ENSMUSP00000112427
Gene: ENSMUSG00000021460

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 142 1.3e-15 PFAM
Pfam:ECH_2 64 139 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123599
AA Change: G17C

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116179
Gene: ENSMUSG00000021460
AA Change: G17C

DomainStartEndE-ValueType
Pfam:ECH_1 21 217 1.7e-48 PFAM
Pfam:ECH_2 25 211 9.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151469
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3' UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Auh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Auh APN 13 52838102 missense probably damaging 1.00
IGL02108:Auh APN 13 52889097 splice site probably benign
IGL02613:Auh APN 13 52918999 critical splice donor site probably null
PIT4131001:Auh UTSW 13 52841010 missense probably damaging 1.00
R0046:Auh UTSW 13 52929385 splice site probably benign
R0741:Auh UTSW 13 52929602 missense possibly damaging 0.53
R1480:Auh UTSW 13 52835496 missense probably benign 0.00
R1515:Auh UTSW 13 52835496 missense probably benign 0.00
R1581:Auh UTSW 13 52835496 missense probably benign 0.00
R1609:Auh UTSW 13 52835496 missense probably benign 0.00
R1611:Auh UTSW 13 52835496 missense probably benign 0.00
R1723:Auh UTSW 13 52835496 missense probably benign 0.00
R1724:Auh UTSW 13 52835496 missense probably benign 0.00
R1725:Auh UTSW 13 52835496 missense probably benign 0.00
R1742:Auh UTSW 13 52835496 missense probably benign 0.00
R1883:Auh UTSW 13 52835496 missense probably benign 0.00
R1884:Auh UTSW 13 52835496 missense probably benign 0.00
R1919:Auh UTSW 13 52835496 missense probably benign 0.00
R2022:Auh UTSW 13 52835496 missense probably benign 0.00
R2071:Auh UTSW 13 52835496 missense probably benign 0.00
R2114:Auh UTSW 13 52835496 missense probably benign 0.00
R2147:Auh UTSW 13 52835496 missense probably benign 0.00
R2149:Auh UTSW 13 52835496 missense probably benign 0.00
R2429:Auh UTSW 13 52919016 missense probably damaging 1.00
R2508:Auh UTSW 13 52898719 nonsense probably null
R2960:Auh UTSW 13 52839574 missense probably damaging 1.00
R3787:Auh UTSW 13 52929457 missense possibly damaging 0.95
R4594:Auh UTSW 13 52912966 unclassified probably benign
R4989:Auh UTSW 13 52841029 missense probably damaging 1.00
R5863:Auh UTSW 13 52898658 missense probably benign 0.06
R6041:Auh UTSW 13 52919086 missense possibly damaging 0.71
R6425:Auh UTSW 13 52841044 missense probably damaging 1.00
R6430:Auh UTSW 13 52929410 missense probably benign 0.41
R6664:Auh UTSW 13 52898667 missense probably damaging 0.99
R6865:Auh UTSW 13 52838129 missense probably damaging 1.00
R7615:Auh UTSW 13 52919013 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACAACTCTCGCACTGACG -3'
(R):5'- AACATACAACATGGCGGCGG -3'

Sequencing Primer
(F):5'- ACTGACGCCTGGGGTAG -3'
(R):5'- CCTTGAGAACGGTTGGCGTC -3'
Posted On2018-05-24