Incidental Mutation 'R6434:Iqgap2'
ID518723
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95682933 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 634 (W634R)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068603
AA Change: W634R

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: W634R

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221667
Meta Mutation Damage Score 0.1842 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATTTAGCAAGCCAGCACATTC -3'
(R):5'- CCCTTTCTAAGCAGAGTCCTCG -3'

Sequencing Primer
(F):5'- GCACATTCAAATCCAGTTCAAGAGG -3'
(R):5'- CTAAGCAGAGTCCTCGTAAACTAGTG -3'
Posted On2018-05-24