Incidental Mutation 'R6434:Klhl33'
ID518724
Institutional Source Beutler Lab
Gene Symbol Klhl33
Ensembl Gene ENSMUSG00000090799
Gene Namekelch-like 33
SynonymsEG546611
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50888582-50897507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50893107 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 310 (A310V)
Ref Sequence ENSEMBL: ENSMUSP00000154785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164415] [ENSMUST00000170855] [ENSMUST00000227271]
Predicted Effect probably damaging
Transcript: ENSMUST00000164415
AA Change: A50V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129810
Gene: ENSMUSG00000090799
AA Change: A50V

DomainStartEndE-ValueType
Pfam:BTB 1 70 5.7e-6 PFAM
BACK 75 176 3.59e-21 SMART
Kelch 273 322 5.26e-3 SMART
Kelch 323 369 7.83e-11 SMART
Kelch 370 418 1.46e-1 SMART
Kelch 419 465 2.84e-8 SMART
Kelch 466 514 6.08e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170855
SMART Domains Protein: ENSMUSP00000131456
Gene: ENSMUSG00000090799

DomainStartEndE-ValueType
SCOP:d1buoa_ 83 129 2e-3 SMART
Blast:BTB 109 170 2e-18 BLAST
SCOP:d1jkjb2 142 198 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226765
Predicted Effect probably damaging
Transcript: ENSMUST00000227271
AA Change: A310V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Klhl33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Klhl33 APN 14 50891431 missense probably benign 0.03
IGL01965:Klhl33 APN 14 50891730 missense probably damaging 1.00
IGL02804:Klhl33 APN 14 50892954 missense probably damaging 1.00
IGL02830:Klhl33 APN 14 50891757 missense probably damaging 1.00
R0309:Klhl33 UTSW 14 50891411 missense probably damaging 0.97
R0520:Klhl33 UTSW 14 50891683 missense probably damaging 1.00
R0671:Klhl33 UTSW 14 50892394 missense probably damaging 0.99
R0894:Klhl33 UTSW 14 50892126 missense probably damaging 0.99
R0989:Klhl33 UTSW 14 50891822 missense probably damaging 1.00
R1681:Klhl33 UTSW 14 50893077 missense probably benign 0.28
R1795:Klhl33 UTSW 14 50892126 missense probably damaging 0.99
R2088:Klhl33 UTSW 14 50892773 nonsense probably null
R3114:Klhl33 UTSW 14 50891515 missense possibly damaging 0.61
R5650:Klhl33 UTSW 14 50891828 missense probably benign 0.08
R5851:Klhl33 UTSW 14 50892878 missense probably damaging 1.00
R5995:Klhl33 UTSW 14 50892651 missense possibly damaging 0.83
R6365:Klhl33 UTSW 14 50891837 missense probably benign
R6803:Klhl33 UTSW 14 50896735 missense probably damaging 0.99
R6881:Klhl33 UTSW 14 50891472 missense probably benign 0.12
R6932:Klhl33 UTSW 14 50891916 missense probably benign 0.03
R6953:Klhl33 UTSW 14 50891516 missense possibly damaging 0.79
R6998:Klhl33 UTSW 14 50893021 missense probably benign 0.00
R7545:Klhl33 UTSW 14 50893174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCACTGTCCAGGAGCTC -3'
(R):5'- TACTGCAGTGCACCGAGTAG -3'

Sequencing Primer
(F):5'- AGCTCAGCCAGGCAGGTAAC -3'
(R):5'- AGTGCACCGAGTAGCCCTG -3'
Posted On2018-05-24