Incidental Mutation 'R6434:Atp6v1c1'
ID518725
Institutional Source Beutler Lab
Gene Symbol Atp6v1c1
Ensembl Gene ENSMUSG00000022295
Gene NameATPase, H+ transporting, lysosomal V1 subunit C1
Synonyms1700025B18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location38661933-38692446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38677546 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 105 (F105S)
Ref Sequence ENSEMBL: ENSMUSP00000022904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022904] [ENSMUST00000226533] [ENSMUST00000228820]
Predicted Effect probably damaging
Transcript: ENSMUST00000022904
AA Change: F105S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022904
Gene: ENSMUSG00000022295
AA Change: F105S

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 370 1.2e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226487
Predicted Effect probably benign
Transcript: ENSMUST00000226533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228486
Predicted Effect probably benign
Transcript: ENSMUST00000228820
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene is one of two genes that encode the V1 domain C subunit proteins and is found ubiquitously. This C subunit is analogous but not homologous to gamma subunit of F-ATPases. Previously, this gene was designated ATP6D. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Atp6v1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Atp6v1c1 APN 15 38686856 missense probably damaging 0.99
IGL01371:Atp6v1c1 APN 15 38682960 missense probably benign
IGL02987:Atp6v1c1 APN 15 38690562 missense possibly damaging 0.70
P0029:Atp6v1c1 UTSW 15 38686902 unclassified probably benign
R0550:Atp6v1c1 UTSW 15 38682929 splice site probably benign
R0669:Atp6v1c1 UTSW 15 38677528 missense probably benign 0.00
R2033:Atp6v1c1 UTSW 15 38673966 critical splice donor site probably null
R3021:Atp6v1c1 UTSW 15 38689216 missense possibly damaging 0.75
R4475:Atp6v1c1 UTSW 15 38677573 missense probably benign 0.03
R4612:Atp6v1c1 UTSW 15 38677612 missense probably damaging 1.00
R4798:Atp6v1c1 UTSW 15 38689176 missense probably damaging 1.00
R5095:Atp6v1c1 UTSW 15 38679413 critical splice donor site probably null
R5600:Atp6v1c1 UTSW 15 38686863 missense probably benign 0.17
R6177:Atp6v1c1 UTSW 15 38673928 nonsense probably null
R6916:Atp6v1c1 UTSW 15 38677581 missense probably benign 0.00
R6973:Atp6v1c1 UTSW 15 38690550 missense probably damaging 1.00
R7395:Atp6v1c1 UTSW 15 38691705 makesense probably null
R7607:Atp6v1c1 UTSW 15 38683011 critical splice donor site probably null
R7712:Atp6v1c1 UTSW 15 38686805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTTAAAAGCAAGCAAAC -3'
(R):5'- TTGGGACCACTAACCACAGG -3'

Sequencing Primer
(F):5'- TGGATCTCTAAGTTAAAGGCCAGCC -3'
(R):5'- AACCGTGATGGGTCGCTG -3'
Posted On2018-05-24