Incidental Mutation 'R6435:Hsdl2'
ID518738
Institutional Source Beutler Lab
Gene Symbol Hsdl2
Ensembl Gene ENSMUSG00000028383
Gene Namehydroxysteroid dehydrogenase like 2
Synonyms2610207I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6435 (G1)
Quality Score150.008
Status Validated
Chromosome4
Chromosomal Location59581563-59618689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59610668 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 222 (Q222K)
Ref Sequence ENSEMBL: ENSMUSP00000103152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030078] [ENSMUST00000107528]
Predicted Effect unknown
Transcript: ENSMUST00000030078
AA Change: Q342K
SMART Domains Protein: ENSMUSP00000030078
Gene: ENSMUSG00000028383
AA Change: Q342K

DomainStartEndE-ValueType
Pfam:KR 11 142 6.3e-7 PFAM
Pfam:adh_short 11 209 2.9e-37 PFAM
Pfam:adh_short_C2 17 217 3.3e-11 PFAM
low complexity region 295 367 N/A INTRINSIC
Pfam:SCP2 382 484 4.1e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000107528
AA Change: Q222K
SMART Domains Protein: ENSMUSP00000103152
Gene: ENSMUSG00000028383
AA Change: Q222K

DomainStartEndE-ValueType
PDB:3KVO|B 1 174 1e-98 PDB
low complexity region 175 247 N/A INTRINSIC
Pfam:SCP2 262 364 2.5e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T C 19: 5,503,418 I112V probably benign Het
Abl1 A T 2: 31,801,549 T1027S possibly damaging Het
Ablim1 T C 19: 57,061,355 I159V possibly damaging Het
Adcy1 A G 11: 7,161,367 N886S possibly damaging Het
Baz1b G A 5: 135,237,945 D1203N probably damaging Het
Chmp2a A T 7: 13,032,774 Y72* probably null Het
Col6a1 A T 10: 76,711,123 I755N unknown Het
Defa24 T A 8: 21,734,674 F46L possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gcn1l1 A T 5: 115,611,022 probably null Het
Gfpt2 A G 11: 49,835,651 S628G probably benign Het
Gm4969 T C 7: 19,100,919 probably benign Het
Ighv1-9 T A 12: 114,583,586 I111F probably benign Het
Itch G A 2: 155,209,129 D579N probably benign Het
Jdp2 A T 12: 85,608,358 K65M probably damaging Het
Kif15 A T 9: 122,986,491 E222V probably damaging Het
Map1b A G 13: 99,516,363 V42A probably damaging Het
Mecom T A 3: 29,980,249 E426V probably damaging Het
Mfsd6 G T 1: 52,709,444 Y87* probably null Het
Mybpc2 A G 7: 44,506,057 V924A possibly damaging Het
Naip6 A T 13: 100,294,741 M1196K probably benign Het
Olfr669 A G 7: 104,938,834 M103V probably damaging Het
Pcdh9 G A 14: 93,887,844 P297S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rgs21 A G 1: 144,519,827 F108L probably damaging Het
Runx1 A T 16: 92,644,295 S209T possibly damaging Het
Sdccag8 G T 1: 176,814,862 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tsc1 G A 2: 28,676,452 V627M probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp612 A G 8: 110,089,320 I347M probably damaging Het
Other mutations in Hsdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Hsdl2 APN 4 59596892 missense probably benign 0.26
IGL00857:Hsdl2 APN 4 59617735 missense probably benign 0.29
IGL01859:Hsdl2 APN 4 59601569 critical splice donor site probably null
IGL02822:Hsdl2 APN 4 59601379 missense possibly damaging 0.55
IGL03028:Hsdl2 APN 4 59594471 missense probably damaging 0.98
IGL03275:Hsdl2 APN 4 59617747 makesense probably null
R0217:Hsdl2 UTSW 4 59597311 missense probably damaging 1.00
R0294:Hsdl2 UTSW 4 59601408 missense probably benign 0.00
R0448:Hsdl2 UTSW 4 59606523 missense unknown
R0490:Hsdl2 UTSW 4 59612814 splice site probably benign
R1353:Hsdl2 UTSW 4 59596971 splice site probably null
R1668:Hsdl2 UTSW 4 59612697 missense probably damaging 1.00
R3933:Hsdl2 UTSW 4 59597274 missense probably damaging 1.00
R4088:Hsdl2 UTSW 4 59610636 missense unknown
R4247:Hsdl2 UTSW 4 59594417 missense probably damaging 1.00
R4449:Hsdl2 UTSW 4 59617692 missense possibly damaging 0.61
R4723:Hsdl2 UTSW 4 59593270 unclassified probably benign
R4858:Hsdl2 UTSW 4 59612812 critical splice donor site probably null
R5361:Hsdl2 UTSW 4 59592301 unclassified probably benign
R6525:Hsdl2 UTSW 4 59612696 missense probably damaging 0.99
R6536:Hsdl2 UTSW 4 59610508 critical splice acceptor site probably null
R7156:Hsdl2 UTSW 4 59617653 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCTTATACTGCCAAAACTTTAAGGC -3'
(R):5'- CTGAGAGTTCAAACTGATAGACAGC -3'

Sequencing Primer
(F):5'- CTGCCAAAACTTTAAGGCTCTTTATG -3'
(R):5'- GACAGCTTGTGTCGCTCTAACAAC -3'
Posted On2018-05-24