Incidental Mutation 'R6435:Jdp2'
ID518754
Institutional Source Beutler Lab
Gene Symbol Jdp2
Ensembl Gene ENSMUSG00000034271
Gene NameJun dimerization protein 2
SynonymsTIF, Jundm2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6435 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location85599027-85639878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85608358 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 65 (K65M)
Ref Sequence ENSEMBL: ENSMUSP00000136823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050687] [ENSMUST00000171754] [ENSMUST00000177587] [ENSMUST00000222689]
Predicted Effect probably damaging
Transcript: ENSMUST00000050687
AA Change: K65M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059724
Gene: ENSMUSG00000034271
AA Change: K65M

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BRLZ 70 134 6.61e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171754
AA Change: K65M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129985
Gene: ENSMUSG00000034271
AA Change: K65M

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BRLZ 70 134 6.61e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177587
AA Change: K65M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136823
Gene: ENSMUSG00000034271
AA Change: K65M

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BRLZ 70 134 6.61e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222689
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased white adipose tissue differentiation, short tail, and enhanced would healing due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T C 19: 5,503,418 I112V probably benign Het
Abl1 A T 2: 31,801,549 T1027S possibly damaging Het
Ablim1 T C 19: 57,061,355 I159V possibly damaging Het
Adcy1 A G 11: 7,161,367 N886S possibly damaging Het
Baz1b G A 5: 135,237,945 D1203N probably damaging Het
Chmp2a A T 7: 13,032,774 Y72* probably null Het
Col6a1 A T 10: 76,711,123 I755N unknown Het
Defa24 T A 8: 21,734,674 F46L possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gcn1l1 A T 5: 115,611,022 probably null Het
Gfpt2 A G 11: 49,835,651 S628G probably benign Het
Gm4969 T C 7: 19,100,919 probably benign Het
Hsdl2 C A 4: 59,610,668 Q222K unknown Het
Ighv1-9 T A 12: 114,583,586 I111F probably benign Het
Itch G A 2: 155,209,129 D579N probably benign Het
Kif15 A T 9: 122,986,491 E222V probably damaging Het
Map1b A G 13: 99,516,363 V42A probably damaging Het
Mecom T A 3: 29,980,249 E426V probably damaging Het
Mfsd6 G T 1: 52,709,444 Y87* probably null Het
Mybpc2 A G 7: 44,506,057 V924A possibly damaging Het
Naip6 A T 13: 100,294,741 M1196K probably benign Het
Olfr669 A G 7: 104,938,834 M103V probably damaging Het
Pcdh9 G A 14: 93,887,844 P297S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rgs21 A G 1: 144,519,827 F108L probably damaging Het
Runx1 A T 16: 92,644,295 S209T possibly damaging Het
Sdccag8 G T 1: 176,814,862 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tsc1 G A 2: 28,676,452 V627M probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp612 A G 8: 110,089,320 I347M probably damaging Het
Other mutations in Jdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Jdp2 APN 12 85608246 missense probably benign 0.22
PIT4305001:Jdp2 UTSW 12 85638852 missense probably damaging 1.00
R6177:Jdp2 UTSW 12 85638840 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATCCCAGACCCTTCAGTGAC -3'
(R):5'- TCTCACTTCCTAGACCCACAGG -3'

Sequencing Primer
(F):5'- AGACCCTTCAGTGACCGCAG -3'
(R):5'- TGGCAGCTCAAACTTGAATGC -3'
Posted On2018-05-24