Incidental Mutation 'R6436:Rcsd1'
ID518765
Institutional Source Beutler Lab
Gene Symbol Rcsd1
Ensembl Gene ENSMUSG00000040723
Gene NameRCSD domain containing 1
SynonymsA430105K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location165646516-165709757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165657615 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 90 (S90C)
Ref Sequence ENSEMBL: ENSMUSP00000095082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040357] [ENSMUST00000097474]
Predicted Effect probably damaging
Transcript: ENSMUST00000040357
AA Change: S120C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043724
Gene: ENSMUSG00000040723
AA Change: S120C

DomainStartEndE-ValueType
Pfam:CAP-ZIP_m 76 207 6.7e-25 PFAM
Pfam:RCSD 230 329 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097474
AA Change: S90C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095082
Gene: ENSMUSG00000040723
AA Change: S90C

DomainStartEndE-ValueType
Pfam:CAP-ZIP_m 45 174 3.1e-25 PFAM
Meta Mutation Damage Score 0.1457 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Rcsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Rcsd1 APN 1 165657579 missense probably damaging 1.00
P0028:Rcsd1 UTSW 1 165655997 missense probably damaging 1.00
R1791:Rcsd1 UTSW 1 165655972 missense probably damaging 1.00
R1898:Rcsd1 UTSW 1 165659429 missense probably benign 0.14
R2260:Rcsd1 UTSW 1 165659429 missense probably benign 0.14
R2280:Rcsd1 UTSW 1 165659429 missense probably benign 0.14
R4427:Rcsd1 UTSW 1 165655895 missense probably damaging 0.99
R4679:Rcsd1 UTSW 1 165655924 missense probably damaging 1.00
R5327:Rcsd1 UTSW 1 165655303 critical splice donor site probably null
R5560:Rcsd1 UTSW 1 165655501 missense possibly damaging 0.79
R6327:Rcsd1 UTSW 1 165655834 missense possibly damaging 0.85
R7267:Rcsd1 UTSW 1 165663616 missense probably damaging 1.00
R7682:Rcsd1 UTSW 1 165657693 missense probably benign 0.41
R8043:Rcsd1 UTSW 1 165655342 missense probably benign 0.03
Y4337:Rcsd1 UTSW 1 165655684 missense possibly damaging 0.74
Z1177:Rcsd1 UTSW 1 165655744 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAACACTTAAAAGTTTCCTCAGC -3'
(R):5'- ATCCAAGGTGTCGGGTAGG -3'

Sequencing Primer
(F):5'- GTTTCCTCAGCACACCACAGTC -3'
(R):5'- TAGGCCATGCTTCTGGAAC -3'
Posted On2018-05-24