Incidental Mutation 'R6436:Lcn8'
ID518766
Institutional Source Beutler Lab
Gene Symbol Lcn8
Ensembl Gene ENSMUSG00000036449
Gene Namelipocalin 8
SynonymsEP17, 9230106L18Rik, mEP17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25653120-25656217 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 25654978 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028306] [ENSMUST00000038482] [ENSMUST00000100312] [ENSMUST00000100313]
Predicted Effect probably null
Transcript: ENSMUST00000028306
SMART Domains Protein: ENSMUSP00000028306
Gene: ENSMUSG00000026937

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Lipocalin 41 180 1.6e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038482
SMART Domains Protein: ENSMUSP00000043902
Gene: ENSMUSG00000036449

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lipocalin 33 159 2.9e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100312
SMART Domains Protein: ENSMUSP00000097887
Gene: ENSMUSG00000026937

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Lipocalin 41 180 1.6e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100313
SMART Domains Protein: ENSMUSP00000097888
Gene: ENSMUSG00000026937

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Lipocalin 41 180 2.5e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the lipocalin family, such as LCN8, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Lcn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Lcn8 APN 2 25655107 unclassified probably benign
IGL01554:Lcn8 APN 2 25654186 missense possibly damaging 0.95
IGL01947:Lcn8 APN 2 25655145 missense probably damaging 1.00
IGL03107:Lcn8 APN 2 25655365 missense probably damaging 1.00
R5945:Lcn8 UTSW 2 25655497 missense probably damaging 1.00
R7835:Lcn8 UTSW 2 25655296 splice site probably null
R8072:Lcn8 UTSW 2 25655172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACTGGGTTCAGAAAGAGACAC -3'
(R):5'- TTCAGGATGGTGTAGCGCTC -3'

Sequencing Primer
(F):5'- AGACACTGTGGGGGAATTTGC -3'
(R):5'- ATGGTGTAGCGCTCATAGTCC -3'
Posted On2018-05-24