Incidental Mutation 'R6436:Gm10770'
ID518768
Institutional Source Beutler Lab
Gene Symbol Gm10770
Ensembl Gene ENSMUSG00000074837
Gene Namepredicted gene 10770
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150178882-150179679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150178910 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 229 (T229I)
Ref Sequence ENSEMBL: ENSMUSP00000097015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099418] [ENSMUST00000109926]
Predicted Effect probably benign
Transcript: ENSMUST00000099418
AA Change: T229I

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097015
Gene: ENSMUSG00000074837
AA Change: T229I

DomainStartEndE-ValueType
ZnF_C2H2 12 34 8.09e0 SMART
ZnF_C2H2 40 62 8.4e1 SMART
ZnF_C2H2 68 90 1.12e-3 SMART
ZnF_C2H2 96 118 3.47e1 SMART
ZnF_C2H2 124 146 1.09e2 SMART
ZnF_C2H2 152 174 3.58e-2 SMART
ZnF_C2H2 180 202 6.23e-2 SMART
ZnF_C2H2 208 230 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109926
SMART Domains Protein: ENSMUSP00000105552
Gene: ENSMUSG00000079009

DomainStartEndE-ValueType
Blast:KRAB 1 34 7e-15 BLAST
ZnF_C2H2 71 93 8.6e-5 SMART
ZnF_C2H2 99 121 1.76e-1 SMART
ZnF_C2H2 127 149 3.02e0 SMART
ZnF_C2H2 183 205 6.08e-5 SMART
ZnF_C2H2 211 233 1.04e-3 SMART
ZnF_C2H2 239 261 2.57e-3 SMART
ZnF_C2H2 267 289 1.06e-4 SMART
ZnF_C2H2 295 317 2.2e-2 SMART
ZnF_C2H2 323 345 4.47e-3 SMART
ZnF_C2H2 351 373 7.37e-4 SMART
ZnF_C2H2 379 401 4.24e-4 SMART
ZnF_C2H2 407 429 1.2e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Gm10770
AlleleSourceChrCoordTypePredicted EffectPPH Score
F5770:Gm10770 UTSW 2 150179484 nonsense probably null
R1765:Gm10770 UTSW 2 150179338 missense probably damaging 1.00
R1842:Gm10770 UTSW 2 150179156 missense probably damaging 1.00
R3438:Gm10770 UTSW 2 150179549 splice site probably null
R4564:Gm10770 UTSW 2 150178911 missense probably benign 0.00
R4863:Gm10770 UTSW 2 150178896 nonsense probably null
R5134:Gm10770 UTSW 2 150179560 splice site probably null
R5424:Gm10770 UTSW 2 150179028 missense probably benign 0.01
R5429:Gm10770 UTSW 2 150179423 missense probably benign 0.00
R5976:Gm10770 UTSW 2 150179400 nonsense probably null
R6679:Gm10770 UTSW 2 150179649 missense probably damaging 1.00
V7580:Gm10770 UTSW 2 150179484 nonsense probably null
V7581:Gm10770 UTSW 2 150179484 nonsense probably null
V7583:Gm10770 UTSW 2 150179484 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAATTCTACTCATGACACAGCCA -3'
(R):5'- CAGGAGAGAAACCCTATGAGTGT -3'

Sequencing Primer
(F):5'- TGTCTCTCAACAGACGAATGG -3'
(R):5'- GGTCAAGCCTTTAGAGTTCACAGTC -3'
Posted On2018-05-24