Incidental Mutation 'R6436:Nop2'
ID518772
Institutional Source Beutler Lab
Gene Symbol Nop2
Ensembl Gene ENSMUSG00000038279
Gene NameNOP2 nucleolar protein
Synonyms120kDa, Nol1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6436 (G1)
Quality Score160.009
Status Validated
Chromosome6
Chromosomal Location125131909-125144753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125137311 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 215 (D215G)
Ref Sequence ENSEMBL: ENSMUSP00000047123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000204185]
Predicted Effect probably benign
Transcript: ENSMUST00000044200
AA Change: D215G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279
AA Change: D215G

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
Pfam:Methyltr_RsmF_N 268 359 2.9e-12 PFAM
Pfam:Nol1_Nop2_Fmu 362 570 2e-86 PFAM
Pfam:P120R 609 630 2.7e-11 PFAM
Pfam:P120R 663 685 1.1e-12 PFAM
low complexity region 729 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204185
SMART Domains Protein: ENSMUSP00000145333
Gene: ENSMUSG00000038279

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Nop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Nop2 APN 6 125133546 missense probably damaging 1.00
IGL00913:Nop2 APN 6 125139821 missense probably damaging 1.00
IGL02568:Nop2 APN 6 125140850 missense probably damaging 1.00
IGL02850:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02850:Nop2 APN 6 125144070 missense probably benign 0.01
IGL02851:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02851:Nop2 APN 6 125144070 missense probably benign 0.01
IGL03144:Nop2 APN 6 125137512 critical splice donor site probably null
IGL03338:Nop2 APN 6 125139732 splice site probably null
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0486:Nop2 UTSW 6 125140673 missense probably null 0.14
R0627:Nop2 UTSW 6 125139704 missense possibly damaging 0.90
R1022:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1024:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1068:Nop2 UTSW 6 125132279 missense probably damaging 0.99
R1750:Nop2 UTSW 6 125137638 missense probably benign 0.00
R1847:Nop2 UTSW 6 125137079 unclassified probably benign
R1940:Nop2 UTSW 6 125134634 missense probably benign 0.43
R1972:Nop2 UTSW 6 125134639 missense probably benign 0.02
R2059:Nop2 UTSW 6 125139860 missense probably null 0.95
R2100:Nop2 UTSW 6 125140822 missense probably damaging 1.00
R3123:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3124:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3160:Nop2 UTSW 6 125134592 missense probably benign 0.00
R3162:Nop2 UTSW 6 125134592 missense probably benign 0.00
R4521:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4522:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4523:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4524:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4571:Nop2 UTSW 6 125140881 critical splice donor site probably null
R4695:Nop2 UTSW 6 125144556 missense probably benign 0.00
R4747:Nop2 UTSW 6 125137094 missense probably benign
R5010:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5385:Nop2 UTSW 6 125144361 missense probably benign
R5455:Nop2 UTSW 6 125140643 missense probably benign 0.19
R5567:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5914:Nop2 UTSW 6 125134728 missense probably benign 0.01
R5993:Nop2 UTSW 6 125144019 missense probably benign 0.00
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6065:Nop2 UTSW 6 125144565 missense probably benign
R6352:Nop2 UTSW 6 125137207 missense probably benign
R7393:Nop2 UTSW 6 125133546 nonsense probably null
R7499:Nop2 UTSW 6 125144208 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGTCTGTCTGGGCTTGAACC -3'
(R):5'- CTTGCTCAGCAGGAAGTCTC -3'

Sequencing Primer
(F):5'- AAGATGATGATGGTGTGTCCCC -3'
(R):5'- TTGCTCAGCAGGAAGTCTCCATAAG -3'
Posted On2018-05-24