Incidental Mutation 'R6436:Fanci'
ID518775
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene NameFanconi anemia, complementation group I
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79391929-79450264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79440698 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 982 (I982T)
Ref Sequence ENSEMBL: ENSMUSP00000044931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000132091]
PDB Structure
Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Structure of a Y DNA-FANCI complex [X-RAY DIFFRACTION]
Structure of FANCI [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000036865
AA Change: I982T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: I982T

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000206121
AA Change: I10T
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79412700 missense probably damaging 1.00
IGL00718:Fanci APN 7 79444174 missense possibly damaging 0.92
IGL00764:Fanci APN 7 79395912 start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79449177 missense probably benign 0.01
IGL02338:Fanci APN 7 79433531 nonsense probably null
IGL02428:Fanci APN 7 79444516 intron probably benign
IGL03029:Fanci APN 7 79443999 missense probably benign 0.00
BB005:Fanci UTSW 7 79444711 missense probably benign
BB015:Fanci UTSW 7 79444711 missense probably benign
P0023:Fanci UTSW 7 79402300 missense probably benign 0.00
P0047:Fanci UTSW 7 79444044 missense probably damaging 1.00
R0310:Fanci UTSW 7 79407417 splice site probably benign
R0388:Fanci UTSW 7 79439630 missense probably benign
R0506:Fanci UTSW 7 79432178 missense probably benign 0.29
R0570:Fanci UTSW 7 79443963 missense probably damaging 1.00
R0631:Fanci UTSW 7 79406205 missense probably damaging 1.00
R0746:Fanci UTSW 7 79439681 missense probably damaging 0.99
R0981:Fanci UTSW 7 79405166 missense probably benign 0.01
R1559:Fanci UTSW 7 79433193 missense probably damaging 1.00
R1656:Fanci UTSW 7 79405188 splice site probably benign
R1748:Fanci UTSW 7 79430488 missense probably damaging 1.00
R1815:Fanci UTSW 7 79438308 missense probably damaging 1.00
R2164:Fanci UTSW 7 79395995 missense probably benign 0.22
R3508:Fanci UTSW 7 79433472 missense probably benign 0.01
R3908:Fanci UTSW 7 79433509 missense possibly damaging 0.91
R4036:Fanci UTSW 7 79444822 missense probably damaging 1.00
R4066:Fanci UTSW 7 79412757 critical splice donor site probably null
R4633:Fanci UTSW 7 79427242 missense probably damaging 1.00
R4651:Fanci UTSW 7 79435256 missense possibly damaging 0.74
R4993:Fanci UTSW 7 79435378 makesense probably null
R5341:Fanci UTSW 7 79406178 missense probably damaging 1.00
R5806:Fanci UTSW 7 79448848 missense probably damaging 0.97
R5898:Fanci UTSW 7 79433321 missense probably benign
R5919:Fanci UTSW 7 79444738 missense probably damaging 1.00
R5960:Fanci UTSW 7 79443762 missense probably damaging 1.00
R6367:Fanci UTSW 7 79426195 missense probably damaging 0.99
R6468:Fanci UTSW 7 79417939 missense probably benign 0.10
R6508:Fanci UTSW 7 79443768 missense probably damaging 0.99
R6886:Fanci UTSW 7 79420342 missense possibly damaging 0.81
R7554:Fanci UTSW 7 79412752 missense probably damaging 0.99
R7588:Fanci UTSW 7 79434269 missense possibly damaging 0.81
R7644:Fanci UTSW 7 79444471 nonsense probably null
R7697:Fanci UTSW 7 79406292 critical splice donor site probably null
R7732:Fanci UTSW 7 79412652 missense possibly damaging 0.65
R7928:Fanci UTSW 7 79444711 missense probably benign
R8170:Fanci UTSW 7 79433557 splice site probably null
R8355:Fanci UTSW 7 79435281 missense probably damaging 1.00
R8425:Fanci UTSW 7 79433541 missense probably benign 0.07
R8429:Fanci UTSW 7 79438385 missense possibly damaging 0.65
R8455:Fanci UTSW 7 79435281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCGCTGTTCGATCCAGG -3'
(R):5'- TTGGTAAGCCAGGGTCCTAC -3'

Sequencing Primer
(F):5'- CGCTGTTCGATCCAGGGTTTC -3'
(R):5'- GGGTCCTACCAACTAGCTACGTC -3'
Posted On2018-05-24