Incidental Mutation 'R6436:Tmc3'
ID518776
Institutional Source Beutler Lab
Gene Symbol Tmc3
Ensembl Gene ENSMUSG00000038540
Gene Nametransmembrane channel-like gene family 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location83584927-83625614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83598487 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 230 (Y230H)
Ref Sequence ENSEMBL: ENSMUSP00000130348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039317] [ENSMUST00000164944]
Predicted Effect probably damaging
Transcript: ENSMUST00000039317
AA Change: Y230H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046028
Gene: ENSMUSG00000038540
AA Change: Y230H

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 5e-42 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1071 1089 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163297
Predicted Effect probably damaging
Transcript: ENSMUST00000164944
AA Change: Y230H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130348
Gene: ENSMUSG00000038540
AA Change: Y230H

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 1.1e-45 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1042 1060 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171397
Meta Mutation Damage Score 0.6312 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Tmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tmc3 APN 7 83603474 missense probably null 1.00
IGL01372:Tmc3 APN 7 83612538 missense probably damaging 1.00
IGL02072:Tmc3 APN 7 83615940 missense probably benign 0.00
IGL02168:Tmc3 APN 7 83619995 missense possibly damaging 0.87
IGL02344:Tmc3 APN 7 83609094 missense probably benign 0.00
IGL02421:Tmc3 APN 7 83622744 missense probably benign
IGL02604:Tmc3 APN 7 83622619 missense possibly damaging 0.85
IGL02863:Tmc3 APN 7 83622286 missense probably benign 0.04
IGL02863:Tmc3 APN 7 83622285 missense possibly damaging 0.61
IGL03058:Tmc3 APN 7 83615886 missense possibly damaging 0.91
IGL03303:Tmc3 APN 7 83590725 splice site probably benign
F5770:Tmc3 UTSW 7 83622505 missense probably benign 0.01
R0133:Tmc3 UTSW 7 83612473 missense probably damaging 1.00
R0147:Tmc3 UTSW 7 83607742 missense probably damaging 1.00
R0304:Tmc3 UTSW 7 83596139 missense probably damaging 1.00
R0320:Tmc3 UTSW 7 83607819 splice site probably benign
R0478:Tmc3 UTSW 7 83622152 missense possibly damaging 0.66
R0714:Tmc3 UTSW 7 83616761 missense possibly damaging 0.94
R1471:Tmc3 UTSW 7 83598290 missense probably damaging 1.00
R1725:Tmc3 UTSW 7 83604732 missense probably damaging 1.00
R1775:Tmc3 UTSW 7 83612532 missense probably benign 0.39
R2176:Tmc3 UTSW 7 83609308 missense probably damaging 1.00
R4001:Tmc3 UTSW 7 83620063 missense probably benign 0.01
R4229:Tmc3 UTSW 7 83597402 intron probably benign
R4635:Tmc3 UTSW 7 83585082 unclassified probably benign
R4715:Tmc3 UTSW 7 83622396 missense probably benign 0.05
R4789:Tmc3 UTSW 7 83622538 missense probably damaging 0.99
R4998:Tmc3 UTSW 7 83622321 missense probably benign 0.16
R5044:Tmc3 UTSW 7 83609118 missense probably benign 0.00
R5108:Tmc3 UTSW 7 83619948 missense probably damaging 0.97
R5119:Tmc3 UTSW 7 83615010 missense probably damaging 1.00
R5428:Tmc3 UTSW 7 83612547 missense probably damaging 1.00
R5447:Tmc3 UTSW 7 83622361 missense possibly damaging 0.63
R5767:Tmc3 UTSW 7 83599982 missense probably benign 0.43
R5801:Tmc3 UTSW 7 83622478 missense possibly damaging 0.94
R6115:Tmc3 UTSW 7 83614962 missense possibly damaging 0.47
R6193:Tmc3 UTSW 7 83603335 missense probably benign 0.26
R6478:Tmc3 UTSW 7 83622316 missense probably benign 0.31
R6648:Tmc3 UTSW 7 83597543 missense probably damaging 1.00
R6849:Tmc3 UTSW 7 83586357 missense probably damaging 1.00
R7030:Tmc3 UTSW 7 83616817 splice site probably null
R7085:Tmc3 UTSW 7 83622145 missense possibly damaging 0.88
R7574:Tmc3 UTSW 7 83598273 missense probably damaging 0.99
R7685:Tmc3 UTSW 7 83597458 missense probably damaging 1.00
R7888:Tmc3 UTSW 7 83600009 missense probably damaging 1.00
R8474:Tmc3 UTSW 7 83609914 missense probably damaging 1.00
V7581:Tmc3 UTSW 7 83622505 missense probably benign 0.01
Z1088:Tmc3 UTSW 7 83603468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTACACCCAGACCTTG -3'
(R):5'- TCAGCATACAGTAAGTGCTGG -3'

Sequencing Primer
(F):5'- CCTTGCGGGAGAGCTGAAG -3'
(R):5'- CATACAGTAAGTGCTGGCTAAAC -3'
Posted On2018-05-24