Incidental Mutation 'R6436:Itgb3'
ID518782
Institutional Source Beutler Lab
Gene Symbol Itgb3
Ensembl Gene ENSMUSG00000020689
Gene Nameintegrin beta 3
SynonymsCD61, platelet glycoprotein IIIa (GP3A)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104608000-104670476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104633492 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 151 (D151E)
Ref Sequence ENSEMBL: ENSMUSP00000021028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021028]
Predicted Effect probably damaging
Transcript: ENSMUST00000021028
AA Change: D151E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021028
Gene: ENSMUSG00000020689
AA Change: D151E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PSI 29 75 4.43e-5 SMART
INB 37 460 3.16e-276 SMART
VWA 136 395 8.65e-2 SMART
Pfam:EGF_2 511 546 6.8e-7 PFAM
Pfam:EGF_2 553 583 8.1e-7 PFAM
Integrin_B_tail 633 717 1.07e-28 SMART
Integrin_b_cyt 741 787 1.78e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127140
Meta Mutation Damage Score 0.8711 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit platelet defects, extended bleeding times, cutaneous and gastrointestinal bleeding, anemia, increased bone mass, hypocalcemia, reduced survival, and placental defects associated with some fetal loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Itgb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itgb3 APN 11 104633584 missense probably damaging 1.00
IGL01460:Itgb3 APN 11 104662394 nonsense probably null
IGL01615:Itgb3 APN 11 104643965 missense probably damaging 1.00
IGL01669:Itgb3 APN 11 104633390 splice site probably benign
IGL02057:Itgb3 APN 11 104632348 missense probably damaging 1.00
IGL02192:Itgb3 APN 11 104643939 missense probably benign
IGL02604:Itgb3 APN 11 104662443 missense probably damaging 0.99
IGL02708:Itgb3 APN 11 104637829 missense possibly damaging 0.60
IGL02901:Itgb3 APN 11 104637946 missense probably benign 0.18
IGL03288:Itgb3 APN 11 104633467 missense probably damaging 1.00
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0123:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R0125:Itgb3 UTSW 11 104643963 missense probably damaging 1.00
R0637:Itgb3 UTSW 11 104658876 missense probably benign 0.02
R2017:Itgb3 UTSW 11 104637962 missense possibly damaging 0.70
R2045:Itgb3 UTSW 11 104623413 missense probably benign
R2200:Itgb3 UTSW 11 104640986 splice site probably null
R2225:Itgb3 UTSW 11 104665510 missense probably benign 0.00
R2429:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R3820:Itgb3 UTSW 11 104633612 nonsense probably null
R4863:Itgb3 UTSW 11 104665520 missense probably damaging 1.00
R5116:Itgb3 UTSW 11 104641077 missense probably benign 0.20
R5301:Itgb3 UTSW 11 104633654 splice site probably null
R5933:Itgb3 UTSW 11 104637979 missense possibly damaging 0.63
R6361:Itgb3 UTSW 11 104665582 missense possibly damaging 0.72
R6452:Itgb3 UTSW 11 104633464 nonsense probably null
R7196:Itgb3 UTSW 11 104633612 nonsense probably null
R7438:Itgb3 UTSW 11 104643577 missense possibly damaging 0.90
R8006:Itgb3 UTSW 11 104665496 missense possibly damaging 0.56
R8068:Itgb3 UTSW 11 104665511 missense probably benign 0.35
R8378:Itgb3 UTSW 11 104642316 missense possibly damaging 0.95
Z1176:Itgb3 UTSW 11 104643623 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGCAGTTATTAACCCTCCATGGAG -3'
(R):5'- TTGGACCAGCCTTTGATCAAG -3'

Sequencing Primer
(F):5'- AGGCCTGCTCGTGTATTTGATCC -3'
(R):5'- CACTGGCTTGTGGAGAAAGTC -3'
Posted On2018-05-24