Incidental Mutation 'R6436:Parg'
ID518786
Institutional Source Beutler Lab
Gene Symbol Parg
Ensembl Gene ENSMUSG00000021911
Gene Namepoly (ADP-ribose) glycohydrolase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6436 (G1)
Quality Score202.009
Status Validated
Chromosome14
Chromosomal Location32201949-32297550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32271677 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 289 (W289R)
Ref Sequence ENSEMBL: ENSMUSP00000132454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022470] [ENSMUST00000163350] [ENSMUST00000170129] [ENSMUST00000170840]
Predicted Effect probably damaging
Transcript: ENSMUST00000022470
AA Change: W794R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022470
Gene: ENSMUSG00000021911
AA Change: W794R

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 574 902 2.5e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163350
AA Change: W794R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131566
Gene: ENSMUSG00000021911
AA Change: W794R

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 570 905 5.1e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165950
Predicted Effect probably benign
Transcript: ENSMUST00000170129
Predicted Effect probably damaging
Transcript: ENSMUST00000170840
AA Change: W289R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132454
Gene: ENSMUSG00000021911
AA Change: W289R

DomainStartEndE-ValueType
Pfam:PARG_cat 117 452 9.7e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171871
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) glycohydrolase (PARG) is the major enzyme responsible for the catabolism of poly(ADP-ribose), a reversible covalent-modifier of chromosomal proteins. The protein is found in many tissues and may be subject to proteolysis generating smaller, active products. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for one allele of this gene are hypersensitive to alkylating agents and ionizing radiation and susceptible to streptozotocin induced diabetes and endotoxic shock. Mice homozygous for a second allele display embryonic lethality and fail tohatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Parg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Parg APN 14 32296185 splice site probably benign
IGL01879:Parg APN 14 32271622 splice site probably benign
IGL02391:Parg APN 14 32262681 splice site probably null
IGL02451:Parg APN 14 32242229 missense probably damaging 1.00
IGL02598:Parg APN 14 32214324 missense probably damaging 1.00
IGL02899:Parg APN 14 32238574 missense probably damaging 1.00
R0112:Parg UTSW 14 32202433 missense probably damaging 1.00
R0167:Parg UTSW 14 32217736 critical splice donor site probably null
R0514:Parg UTSW 14 32254560 missense possibly damaging 0.69
R0834:Parg UTSW 14 32214554 splice site probably benign
R1140:Parg UTSW 14 32296243 missense probably benign 0.01
R1480:Parg UTSW 14 32209628 nonsense probably null
R1611:Parg UTSW 14 32238570 missense probably damaging 1.00
R1912:Parg UTSW 14 32210540 missense probably damaging 0.99
R1916:Parg UTSW 14 32208227 splice site probably benign
R1983:Parg UTSW 14 32217696 missense probably damaging 1.00
R2007:Parg UTSW 14 32210574 missense possibly damaging 0.87
R2275:Parg UTSW 14 32295238 missense probably damaging 0.98
R2942:Parg UTSW 14 32209337 missense probably damaging 1.00
R4206:Parg UTSW 14 32254536 missense probably benign 0.07
R4482:Parg UTSW 14 32262774 missense probably damaging 1.00
R4512:Parg UTSW 14 32262736 missense probably damaging 1.00
R4519:Parg UTSW 14 32209635 missense probably damaging 1.00
R4611:Parg UTSW 14 32274864 missense probably damaging 1.00
R4831:Parg UTSW 14 32202451 missense probably benign 0.00
R4876:Parg UTSW 14 32271668 missense probably damaging 0.98
R5298:Parg UTSW 14 32202253 missense probably damaging 1.00
R5606:Parg UTSW 14 32262736 missense probably damaging 1.00
R5782:Parg UTSW 14 32274905 nonsense probably null
R5878:Parg UTSW 14 32217662 missense possibly damaging 0.85
R6373:Parg UTSW 14 32209497 splice site probably null
R6530:Parg UTSW 14 32209199 missense probably damaging 1.00
R7285:Parg UTSW 14 32210508 missense probably damaging 0.98
R7348:Parg UTSW 14 32250079 missense possibly damaging 0.82
R7455:Parg UTSW 14 32209475 missense probably benign
R7780:Parg UTSW 14 32208801 missense possibly damaging 0.94
R7887:Parg UTSW 14 32217662 missense possibly damaging 0.85
R7968:Parg UTSW 14 32214370 missense possibly damaging 0.57
R8153:Parg UTSW 14 32262820 missense probably damaging 1.00
R8494:Parg UTSW 14 32209021 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGTAGTAAGCATGACAGTCTC -3'
(R):5'- CACAGAGAAACCCTGTCTCG -3'

Sequencing Primer
(F):5'- GTCTATGTAGTGAGTTCCAAGACAGC -3'
(R):5'- CCCTGTCTCGAAAAACCAAGAG -3'
Posted On2018-05-24