Mutagenetix > Incidental Mutations

Incidental Mutation 'R6436:Parg'

518786

Institutional Source

Beutler Lab

Gene Symbol

Parg

Ensembl Gene

ENSMUSG00000021911

Gene Name

poly (ADP-ribose) glycohydrolase

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6436 (G1)

Quality Score

202.009

Status

Validated

Chromosome

Chromosomal Location

32201949-32297550 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32271677 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 289 (W289R)

Ref Sequence

ENSEMBL: ENSMUSP00000132454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022470] [ENSMUST00000163350] [ENSMUST00000170129] [ENSMUST00000170840]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022470
AA Change: W794R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022470
Gene: ENSMUSG00000021911
AA Change: W794R

Domain	Start	End	E-Value	Type
low complexity region	190	204	N/A	INTRINSIC
low complexity region	286	298	N/A	INTRINSIC
Pfam:PARG_cat	574	902	2.5e-135	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163350
AA Change: W794R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131566
Gene: ENSMUSG00000021911
AA Change: W794R

Domain	Start	End	E-Value	Type
low complexity region	190	204	N/A	INTRINSIC
low complexity region	286	298	N/A	INTRINSIC
Pfam:PARG_cat	570	905	5.1e-134	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165950

Predicted Effect

probably benign
Transcript: ENSMUST00000170129

Predicted Effect

probably damaging
Transcript: ENSMUST00000170840
AA Change: W289R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132454
Gene: ENSMUSG00000021911
AA Change: W289R

Domain	Start	End	E-Value	Type
Pfam:PARG_cat	117	452	9.7e-135	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171871

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.5%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) glycohydrolase (PARG) is the major enzyme responsible for the catabolism of poly(ADP-ribose), a reversible covalent-modifier of chromosomal proteins. The protein is found in many tissues and may be subject to proteolysis generating smaller, active products. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for one allele of this gene are hypersensitive to alkylating agents and ionizing radiation and susceptible to streptozotocin induced diabetes and endotoxic shock. Mice homozygous for a second allele display embryonic lethality and fail tohatch from the zona pellucida. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arc	C	A	15: 74,672,249	V42L	possibly damaging	Het
Clip1	C	T	5: 123,641,785	E433K	probably damaging	Het
Cmya5	T	C	13: 93,089,215	T3122A	probably damaging	Het
Ctf2	G	T	7: 127,719,431	A92E	probably damaging	Het
Ctsw	G	T	19: 5,466,294	R184S	possibly damaging	Het
D130043K22Rik	A	G	13: 24,877,935	E629G	probably damaging	Het
Dmbt1	T	C	7: 131,116,641	V1523A	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fanci	T	C	7: 79,440,698	I982T	probably benign	Het
Fnbp1	T	C	2: 31,096,127	D3G	probably damaging	Het
Gm10770	G	A	2: 150,178,910	T229I	probably benign	Het
Gm35315	G	A	5: 110,078,712	T287I	probably benign	Het
Itgb3	T	A	11: 104,633,492	D151E	probably damaging	Het
Lcn8	A	T	2: 25,654,978		probably null	Het
Ninl	A	G	2: 150,966,178	L310P	probably damaging	Het
Nop2	A	G	6: 125,137,311	D215G	probably benign	Het
Olfr1426	T	C	19: 12,087,935	T286A	probably benign	Het
Olfr788	A	G	10: 129,472,904	T71A	probably damaging	Het
Pdcd4	A	G	19: 53,926,931		probably null	Het
Plk2	G	T	13: 110,396,036	E95*	probably null	Het
Pold1	G	A	7: 44,538,778	R559C	probably damaging	Het
Ptprc	T	C	1: 138,083,639	D560G	possibly damaging	Het
Rasal3	T	C	17: 32,397,504	Y290C	probably damaging	Het
Rcsd1	T	A	1: 165,657,615	S90C	probably damaging	Het
Rttn	T	C	18: 89,110,729	L1935P	probably damaging	Het
Smc1b	C	T	15: 85,092,031	R825Q	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Homo
Tmc3	T	C	7: 83,598,487	Y230H	probably damaging	Het
Tnfrsf25	A	T	4: 152,119,627		probably null	Het
Ubl7	T	C	9: 57,920,510	L160P	probably damaging	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Zfp646	T	A	7: 127,879,941	V430E	probably benign	Het

Other mutations in Parg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01324:Parg	APN	14	32296185	splice site	probably benign
IGL01879:Parg	APN	14	32271622	splice site	probably benign
IGL02391:Parg	APN	14	32262681	splice site	probably null
IGL02451:Parg	APN	14	32242229	missense	probably damaging	1.00
IGL02598:Parg	APN	14	32214324	missense	probably damaging	1.00
IGL02899:Parg	APN	14	32238574	missense	probably damaging	1.00
R0112:Parg	UTSW	14	32202433	missense	probably damaging	1.00
R0167:Parg	UTSW	14	32217736	critical splice donor site	probably null
R0514:Parg	UTSW	14	32254560	missense	possibly damaging	0.69
R0834:Parg	UTSW	14	32214554	splice site	probably benign
R1140:Parg	UTSW	14	32296243	missense	probably benign	0.01
R1480:Parg	UTSW	14	32209628	nonsense	probably null
R1611:Parg	UTSW	14	32238570	missense	probably damaging	1.00
R1912:Parg	UTSW	14	32210540	missense	probably damaging	0.99
R1916:Parg	UTSW	14	32208227	splice site	probably benign
R1983:Parg	UTSW	14	32217696	missense	probably damaging	1.00
R2007:Parg	UTSW	14	32210574	missense	possibly damaging	0.87
R2275:Parg	UTSW	14	32295238	missense	probably damaging	0.98
R2942:Parg	UTSW	14	32209337	missense	probably damaging	1.00
R4206:Parg	UTSW	14	32254536	missense	probably benign	0.07
R4482:Parg	UTSW	14	32262774	missense	probably damaging	1.00
R4512:Parg	UTSW	14	32262736	missense	probably damaging	1.00
R4519:Parg	UTSW	14	32209635	missense	probably damaging	1.00
R4611:Parg	UTSW	14	32274864	missense	probably damaging	1.00
R4831:Parg	UTSW	14	32202451	missense	probably benign	0.00
R4876:Parg	UTSW	14	32271668	missense	probably damaging	0.98
R5298:Parg	UTSW	14	32202253	missense	probably damaging	1.00
R5606:Parg	UTSW	14	32262736	missense	probably damaging	1.00
R5782:Parg	UTSW	14	32274905	nonsense	probably null
R5878:Parg	UTSW	14	32217662	missense	possibly damaging	0.85
R6373:Parg	UTSW	14	32209497	splice site	probably null
R6530:Parg	UTSW	14	32209199	missense	probably damaging	1.00
R7285:Parg	UTSW	14	32210508	missense	probably damaging	0.98
R7348:Parg	UTSW	14	32250079	missense	possibly damaging	0.82
R7455:Parg	UTSW	14	32209475	missense	probably benign
R7780:Parg	UTSW	14	32208801	missense	possibly damaging	0.94
R7887:Parg	UTSW	14	32217662	missense	possibly damaging	0.85
R7968:Parg	UTSW	14	32214370	missense	possibly damaging	0.57
R8153:Parg	UTSW	14	32262820	missense	probably damaging	1.00
R8494:Parg	UTSW	14	32209021	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGGTAGTAAGCATGACAGTCTC -3'
(R):5'- CACAGAGAAACCCTGTCTCG -3'

Sequencing Primer
(F):5'- GTCTATGTAGTGAGTTCCAAGACAGC -3'
(R):5'- CCCTGTCTCGAAAAACCAAGAG -3'

Posted On

2018-05-24