Incidental Mutation 'R6436:Smc1b'
ID 518788
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Name structural maintenance of chromosomes 1B
Synonyms Smc1l2, SMC1beta
MMRRC Submission 044574-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.696) question?
Stock # R6436 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 84948890-85016158 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84976232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 825 (R825Q)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]
AlphaFold Q920F6
Predicted Effect probably benign
Transcript: ENSMUST00000023068
AA Change: R825Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: R825Q

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,544,098 (GRCm39) V42L possibly damaging Het
Clip1 C T 5: 123,779,848 (GRCm39) E433K probably damaging Het
Cmya5 T C 13: 93,225,723 (GRCm39) T3122A probably damaging Het
Ctf2 G T 7: 127,318,603 (GRCm39) A92E probably damaging Het
Ctsw G T 19: 5,516,322 (GRCm39) R184S possibly damaging Het
D130043K22Rik A G 13: 25,061,918 (GRCm39) E629G probably damaging Het
Dmbt1 T C 7: 130,718,370 (GRCm39) V1523A probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fanci T C 7: 79,090,446 (GRCm39) I982T probably benign Het
Fnbp1 T C 2: 30,986,139 (GRCm39) D3G probably damaging Het
Gm10770 G A 2: 150,020,830 (GRCm39) T229I probably benign Het
Gm35315 G A 5: 110,226,578 (GRCm39) T287I probably benign Het
Itgb3 T A 11: 104,524,318 (GRCm39) D151E probably damaging Het
Lcn8 A T 2: 25,544,990 (GRCm39) probably null Het
Ninl A G 2: 150,808,098 (GRCm39) L310P probably damaging Het
Nop2 A G 6: 125,114,274 (GRCm39) D215G probably benign Het
Or4d10c T C 19: 12,065,299 (GRCm39) T286A probably benign Het
Or6c3 A G 10: 129,308,773 (GRCm39) T71A probably damaging Het
Parg T C 14: 31,993,634 (GRCm39) W289R probably damaging Het
Pdcd4 A G 19: 53,915,362 (GRCm39) probably null Het
Plk2 G T 13: 110,532,570 (GRCm39) E95* probably null Het
Pold1 G A 7: 44,188,202 (GRCm39) R559C probably damaging Het
Ptprc T C 1: 138,011,377 (GRCm39) D560G possibly damaging Het
Rasal3 T C 17: 32,616,478 (GRCm39) Y290C probably damaging Het
Rcsd1 T A 1: 165,485,184 (GRCm39) S90C probably damaging Het
Rttn T C 18: 89,128,853 (GRCm39) L1935P probably damaging Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Homo
Tmc3 T C 7: 83,247,695 (GRCm39) Y230H probably damaging Het
Tnfrsf25 A T 4: 152,204,084 (GRCm39) probably null Het
Ubl7 T C 9: 57,827,793 (GRCm39) L160P probably damaging Het
Vmn2r106 C T 17: 20,488,725 (GRCm39) C558Y probably damaging Het
Zfp646 T A 7: 127,479,113 (GRCm39) V430E probably benign Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85,013,901 (GRCm39) missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85,016,099 (GRCm39) missense probably damaging 1.00
IGL01656:Smc1b APN 15 84,998,977 (GRCm39) missense probably damaging 0.99
IGL01807:Smc1b APN 15 84,980,946 (GRCm39) missense probably damaging 0.97
IGL02094:Smc1b APN 15 84,982,092 (GRCm39) splice site probably benign
IGL02121:Smc1b APN 15 84,982,186 (GRCm39) missense probably benign
IGL02631:Smc1b APN 15 84,991,204 (GRCm39) missense probably damaging 0.98
IGL02678:Smc1b APN 15 84,949,201 (GRCm39) nonsense probably null
IGL03197:Smc1b APN 15 84,955,064 (GRCm39) missense possibly damaging 0.85
IGL03214:Smc1b APN 15 84,982,147 (GRCm39) nonsense probably null
IGL03218:Smc1b APN 15 84,973,914 (GRCm39) missense probably benign 0.07
IGL03232:Smc1b APN 15 85,013,921 (GRCm39) missense possibly damaging 0.68
adamantine UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
unbreakable UTSW 15 84,980,859 (GRCm39) missense probably benign
E0370:Smc1b UTSW 15 85,011,782 (GRCm39) missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 84,953,852 (GRCm39) missense possibly damaging 0.91
R0092:Smc1b UTSW 15 84,951,925 (GRCm39) unclassified probably benign
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0207:Smc1b UTSW 15 85,007,960 (GRCm39) missense probably benign
R0390:Smc1b UTSW 15 84,950,478 (GRCm39) missense probably damaging 1.00
R0440:Smc1b UTSW 15 84,996,874 (GRCm39) splice site probably benign
R0685:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R1109:Smc1b UTSW 15 84,997,016 (GRCm39) missense probably damaging 0.98
R1392:Smc1b UTSW 15 84,991,271 (GRCm39) splice site probably benign
R1509:Smc1b UTSW 15 84,970,335 (GRCm39) missense probably benign
R1804:Smc1b UTSW 15 85,011,991 (GRCm39) missense possibly damaging 0.90
R1879:Smc1b UTSW 15 84,976,268 (GRCm39) missense probably benign 0.01
R2086:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2143:Smc1b UTSW 15 85,008,003 (GRCm39) missense probably benign
R2158:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2174:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2471:Smc1b UTSW 15 84,976,218 (GRCm39) missense probably damaging 0.98
R3689:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R3690:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R4178:Smc1b UTSW 15 85,004,848 (GRCm39) missense possibly damaging 0.94
R4420:Smc1b UTSW 15 84,997,031 (GRCm39) missense probably damaging 1.00
R4905:Smc1b UTSW 15 84,950,428 (GRCm39) missense probably damaging 1.00
R4919:Smc1b UTSW 15 85,001,305 (GRCm39) intron probably benign
R5114:Smc1b UTSW 15 84,949,185 (GRCm39) missense probably damaging 1.00
R5314:Smc1b UTSW 15 84,955,066 (GRCm39) missense probably benign 0.00
R5476:Smc1b UTSW 15 84,970,352 (GRCm39) missense probably damaging 0.97
R5593:Smc1b UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
R5690:Smc1b UTSW 15 84,996,974 (GRCm39) missense probably damaging 1.00
R5719:Smc1b UTSW 15 84,980,859 (GRCm39) missense probably benign
R5817:Smc1b UTSW 15 84,951,984 (GRCm39) missense probably damaging 0.99
R5834:Smc1b UTSW 15 84,973,866 (GRCm39) missense probably damaging 1.00
R5930:Smc1b UTSW 15 84,970,322 (GRCm39) missense probably damaging 1.00
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85,005,896 (GRCm39) missense probably damaging 1.00
R6306:Smc1b UTSW 15 85,011,824 (GRCm39) missense probably benign 0.30
R6392:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6426:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6435:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6437:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6508:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6512:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6703:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6737:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6775:Smc1b UTSW 15 84,973,881 (GRCm39) missense probably damaging 0.96
R6889:Smc1b UTSW 15 84,951,960 (GRCm39) missense probably damaging 1.00
R6908:Smc1b UTSW 15 84,991,211 (GRCm39) missense probably damaging 1.00
R7124:Smc1b UTSW 15 84,955,798 (GRCm39) missense probably damaging 0.98
R7400:Smc1b UTSW 15 84,953,921 (GRCm39) missense probably damaging 1.00
R7417:Smc1b UTSW 15 84,981,743 (GRCm39) missense probably benign 0.05
R7610:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R7873:Smc1b UTSW 15 84,994,851 (GRCm39) critical splice donor site probably null
R7890:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8004:Smc1b UTSW 15 84,981,815 (GRCm39) missense probably damaging 0.98
R8698:Smc1b UTSW 15 84,997,047 (GRCm39) missense probably benign 0.16
R8826:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8835:Smc1b UTSW 15 85,013,949 (GRCm39) missense possibly damaging 0.83
R8925:Smc1b UTSW 15 84,991,273 (GRCm39) splice site probably null
R9059:Smc1b UTSW 15 85,004,875 (GRCm39) nonsense probably null
R9149:Smc1b UTSW 15 84,950,431 (GRCm39) missense probably benign 0.00
R9241:Smc1b UTSW 15 84,976,209 (GRCm39) missense probably benign 0.00
R9245:Smc1b UTSW 15 85,004,846 (GRCm39) missense probably benign 0.03
R9301:Smc1b UTSW 15 85,011,995 (GRCm39) missense probably damaging 0.98
R9384:Smc1b UTSW 15 84,950,455 (GRCm39) missense probably damaging 0.99
R9750:Smc1b UTSW 15 85,016,106 (GRCm39) missense probably damaging 1.00
Z1176:Smc1b UTSW 15 85,016,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCACAATAAGGCACCATTGG -3'
(R):5'- GGCAATGGCAGTGATTATATTAAGG -3'

Sequencing Primer
(F):5'- GGCACTTCAGCTACTGAT -3'
(R):5'- CAGAGAACACTTACTGCTCTTGGAG -3'
Posted On 2018-05-24