Incidental Mutation 'R6436:Ctsw'
ID518792
Institutional Source Beutler Lab
Gene Symbol Ctsw
Ensembl Gene ENSMUSG00000024910
Gene Namecathepsin W
Synonymslymphopain
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5465240-5468498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5466294 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 184 (R184S)
Ref Sequence ENSEMBL: ENSMUSP00000025844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025844] [ENSMUST00000025847] [ENSMUST00000225141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025844
AA Change: R184S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025844
Gene: ENSMUSG00000024910
AA Change: R184S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 40 97 2.21e-12 SMART
Pept_C1 126 357 1.58e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025847
SMART Domains Protein: ENSMUSP00000025847
Gene: ENSMUSG00000024911

DomainStartEndE-ValueType
Pfam:FIBP 3 363 7.6e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224944
Predicted Effect probably benign
Transcript: ENSMUST00000225141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226017
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of the encoded protein is upregulated following lymphocyte activation. Data from a human cell line suggests that the encoded enzyme may be important for viral entry into host cells. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants are fertile and healthy with normal cytotoxic lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Ctsw
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0845:Ctsw UTSW 19 5465461 unclassified probably benign
R1566:Ctsw UTSW 19 5465417 missense probably damaging 1.00
R2306:Ctsw UTSW 19 5466982 splice site probably null
R5023:Ctsw UTSW 19 5466049 missense probably damaging 1.00
R5076:Ctsw UTSW 19 5468458 missense probably benign
R5101:Ctsw UTSW 19 5465675 missense probably benign 0.20
R5112:Ctsw UTSW 19 5466257 missense probably damaging 0.98
R5188:Ctsw UTSW 19 5467092 missense probably damaging 1.00
R6109:Ctsw UTSW 19 5467119 missense probably benign
R6984:Ctsw UTSW 19 5466618 missense probably damaging 1.00
R6993:Ctsw UTSW 19 5465837 missense probably damaging 1.00
R7720:Ctsw UTSW 19 5467044 missense probably damaging 0.99
R9077:Ctsw UTSW 19 5466403 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATCTGTGAGGCTTTCTGTCC -3'
(R):5'- TTCAGGGAAGCTGCAAATGC -3'

Sequencing Primer
(F):5'- GTCCCCCTGGAATGGATAATC -3'
(R):5'- AAATGCTGCTGGGCCATG -3'
Posted On2018-05-24