Incidental Mutation 'R6436:Olfr1426'
ID518793
Institutional Source Beutler Lab
Gene Symbol Olfr1426
Ensembl Gene ENSMUSG00000044994
Gene Nameolfactory receptor 1426
SynonymsGA_x6K02T2RE5P-2447610-2446675, MOR239-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12086746-12092013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12087935 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 286 (T286A)
Ref Sequence ENSEMBL: ENSMUSP00000151988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112952] [ENSMUST00000208703] [ENSMUST00000217952] [ENSMUST00000219005] [ENSMUST00000219155] [ENSMUST00000219996] [ENSMUST00000220005]
Predicted Effect probably benign
Transcript: ENSMUST00000112952
AA Change: T286A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108575
Gene: ENSMUSG00000044994
AA Change: T286A

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 2.1e-49 PFAM
Pfam:7tm_1 39 300 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208703
AA Change: T286A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217952
AA Change: T286A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219005
AA Change: T286A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219155
AA Change: T286A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219996
AA Change: T286A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000220005
AA Change: T286A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Olfr1426
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Olfr1426 APN 19 12087993 missense probably benign 0.28
IGL01549:Olfr1426 APN 19 12087965 missense probably benign 0.20
IGL02479:Olfr1426 APN 19 12087905 missense probably benign 0.01
IGL03065:Olfr1426 APN 19 12088611 missense possibly damaging 0.91
IGL03092:Olfr1426 APN 19 12087866 nonsense probably null
IGL03046:Olfr1426 UTSW 19 12088027 missense probably damaging 0.98
R0734:Olfr1426 UTSW 19 12088119 missense probably benign 0.12
R1190:Olfr1426 UTSW 19 12088687 missense possibly damaging 0.82
R1990:Olfr1426 UTSW 19 12088256 missense probably damaging 0.98
R2331:Olfr1426 UTSW 19 12088158 missense probably benign 0.00
R3500:Olfr1426 UTSW 19 12088057 missense possibly damaging 0.58
R3768:Olfr1426 UTSW 19 12087940 missense probably damaging 1.00
R3825:Olfr1426 UTSW 19 12088027 missense probably damaging 0.98
R4589:Olfr1426 UTSW 19 12087941 missense possibly damaging 0.61
R5175:Olfr1426 UTSW 19 12088562 missense probably damaging 1.00
R6729:Olfr1426 UTSW 19 12088496 missense probably benign 0.04
R6965:Olfr1426 UTSW 19 12088756 missense possibly damaging 0.95
R7099:Olfr1426 UTSW 19 12088166 missense possibly damaging 0.78
R7393:Olfr1426 UTSW 19 12088628 missense probably benign 0.13
R7582:Olfr1426 UTSW 19 12088006 missense probably benign 0.01
R8000:Olfr1426 UTSW 19 12087994 missense probably damaging 0.98
RF011:Olfr1426 UTSW 19 12088247 missense probably benign 0.09
Z1177:Olfr1426 UTSW 19 12087944 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCACACTGTGAAGAAAAGTGAC -3'
(R):5'- ATGGCCTGGTTGCTACTCTG -3'

Sequencing Primer
(F):5'- CACTGTGAAGAAAAGTGACAGACAAG -3'
(R):5'- CTTAGATCTCATTCAGGAGAGGGC -3'
Posted On2018-05-24