Incidental Mutation 'R6437:Mrc2'
ID518828
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6437 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105349843 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1453 (R1453H)
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100335]
Predicted Effect probably damaging
Transcript: ENSMUST00000100335
AA Change: R1453H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: R1453H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Meta Mutation Damage Score 0.2117 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn C T 4: 156,176,778 V514I probably damaging Het
Atg16l1 T C 1: 87,790,648 L545P probably damaging Het
Ces3b T A 8: 105,092,606 D431E probably damaging Het
Cracr2a A G 6: 127,631,831 D291G probably damaging Het
Csmd2 T G 4: 127,988,100 C11G probably benign Het
Dido1 A G 2: 180,675,013 I127T probably damaging Het
Dpp8 A T 9: 65,074,578 Y714F probably benign Het
Efcab5 G A 11: 77,137,902 A201V probably benign Het
Eif3h C T 15: 51,799,264 V129I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fars2 G A 13: 36,204,863 V112I possibly damaging Het
Fbn2 T G 18: 58,113,363 D489A probably damaging Het
Frmd4b G T 6: 97,296,267 S675R probably damaging Het
Fsip2 C T 2: 82,983,492 S3385F possibly damaging Het
Gm4758 A G 16: 36,312,637 E92G probably damaging Het
Gtpbp10 A G 5: 5,557,406 Y12H probably damaging Het
Kcng3 A G 17: 83,631,129 S164P probably damaging Het
Kifap3 T A 1: 163,857,526 L483Q probably damaging Het
Klk10 A G 7: 43,782,817 H58R probably benign Het
Kntc1 T G 5: 123,769,691 W452G probably damaging Het
Krt87 C T 15: 101,438,392 D127N possibly damaging Het
Lipm A G 19: 34,121,257 Y377C probably damaging Het
Nat1 T C 8: 67,491,736 F255L possibly damaging Het
Neb C T 2: 52,257,557 probably null Het
Nek5 T A 8: 22,085,460 D491V possibly damaging Het
Nynrin T C 14: 55,871,770 S1445P probably benign Het
Olfr531 C T 7: 140,400,521 C175Y probably damaging Het
Oog2 T A 4: 144,195,108 probably null Het
Pafah1b1 T C 11: 74,677,731 T391A probably benign Het
Pcdhb7 T C 18: 37,342,690 L293P probably damaging Het
Plce1 A T 19: 38,525,132 T292S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rfx7 A G 9: 72,618,486 Q986R possibly damaging Het
Rrp9 G T 9: 106,482,951 R186L probably benign Het
Samm50 T A 15: 84,204,097 probably null Het
Scoc T C 8: 83,437,987 D7G probably benign Het
Smad9 C T 3: 54,786,084 P145S probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snrk A G 9: 122,166,813 R553G probably damaging Het
Spata5 T A 3: 37,528,198 V794E probably damaging Het
Srcap T A 7: 127,528,550 probably null Het
Syne2 T A 12: 75,990,414 V3789E possibly damaging Het
Thsd7b T C 1: 129,816,682 I769T probably damaging Het
Tmem159 A T 7: 120,116,361 probably null Het
Ttc7 A G 17: 87,330,106 K430E probably damaging Het
Ubr4 T A 4: 139,397,214 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r37 G T 7: 9,217,851 Q338K probably damaging Het
Yod1 T C 1: 130,719,148 V254A probably damaging Het
Zfpm2 T C 15: 41,099,397 S152P probably benign Het
Zmym2 T A 14: 56,903,004 L100H probably damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGTCCCTGTGGTCATGAC -3'
(R):5'- TCCAAAGACAACTGGGCTG -3'

Sequencing Primer
(F):5'- ACTGGGGCCTGATGTGAACTC -3'
(R):5'- ACAACTGGGCTGATGGGTG -3'
Posted On2018-05-24