Mutagenetix > Incidental Mutation

Incidental Mutation 'R6437:Zfpm2'

518833

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41099397 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 152 (S152P)

Ref Sequence

ENSEMBL: ENSMUSP00000155094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably benign
Transcript: ENSMUST00000053467
AA Change: S284P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: S284P

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000230319
AA Change: S152P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0728

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agrn	C	T	4: 156,176,778	V514I	probably damaging	Het
Atg16l1	T	C	1: 87,790,648	L545P	probably damaging	Het
Ces3b	T	A	8: 105,092,606	D431E	probably damaging	Het
Cracr2a	A	G	6: 127,631,831	D291G	probably damaging	Het
Csmd2	T	G	4: 127,988,100	C11G	probably benign	Het
Dido1	A	G	2: 180,675,013	I127T	probably damaging	Het
Dpp8	A	T	9: 65,074,578	Y714F	probably benign	Het
Efcab5	G	A	11: 77,137,902	A201V	probably benign	Het
Eif3h	C	T	15: 51,799,264	V129I	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fars2	G	A	13: 36,204,863	V112I	probably benign	Het
Fbn2	T	G	18: 58,113,363	D489A	probably damaging	Het
Frmd4b	G	T	6: 97,296,267	S675R	probably damaging	Het
Fsip2	C	T	2: 82,983,492	S3385F	possibly damaging	Het
Gm4758	A	G	16: 36,312,637	E92G	probably damaging	Het
Gtpbp10	A	G	5: 5,557,406	Y12H	probably damaging	Het
Kcng3	A	G	17: 83,631,129	S164P	probably damaging	Het
Kifap3	T	A	1: 163,857,526	L483Q	probably damaging	Het
Klk10	A	G	7: 43,782,817	H58R	probably benign	Het
Kntc1	T	G	5: 123,769,691	W452G	probably damaging	Het
Krt87	C	T	15: 101,438,392	D127N	possibly damaging	Het
Lipm	A	G	19: 34,121,257	Y377C	probably damaging	Het
Mrc2	G	A	11: 105,349,843	R1453H	probably damaging	Het
Nat1	T	C	8: 67,491,736	F255L	possibly damaging	Het
Neb	C	T	2: 52,257,557		probably null	Het
Nek5	T	A	8: 22,085,460	D491V	possibly damaging	Het
Nynrin	T	C	14: 55,871,770	S1445P	probably benign	Het
Olfr531	C	T	7: 140,400,521	C175Y	probably damaging	Het
Oog2	T	A	4: 144,195,108		probably null	Het
Pafah1b1	T	C	11: 74,677,731	T391A	probably benign	Het
Pcdhb7	T	C	18: 37,342,690	L293P	probably damaging	Het
Plce1	A	T	19: 38,525,132	T292S	probably benign	Het
Pold1	G	A	7: 44,538,778	R559C	probably damaging	Het
Rfx7	A	G	9: 72,618,486	Q986R	possibly damaging	Het
Rrp9	G	T	9: 106,482,951	R186L	probably benign	Het
Samm50	T	A	15: 84,204,097		probably null	Het
Scoc	T	C	8: 83,437,987	D7G	probably benign	Het
Smad9	C	T	3: 54,786,084	P145S	probably benign	Het
Smc1b	C	T	15: 85,092,031	R825Q	probably benign	Het
Snrk	A	G	9: 122,166,813	R553G	probably damaging	Het
Spata5	T	A	3: 37,528,198	V794E	probably damaging	Het
Srcap	T	A	7: 127,528,550		probably null	Het
Syne2	T	A	12: 75,990,414	V3789E	possibly damaging	Het
Thsd7b	T	C	1: 129,816,682	I769T	probably damaging	Het
Tmem159	A	T	7: 120,116,361		probably null	Het
Ttc7	A	G	17: 87,330,106	K430E	probably damaging	Het
Ubr4	T	A	4: 139,397,214		probably null	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Vmn2r37	G	T	7: 9,217,851	Q338K	probably damaging	Het
Yod1	T	C	1: 130,719,148	V254A	probably damaging	Het
Zmym2	T	A	14: 56,903,004	L100H	probably damaging	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATAATCACTGATGCTCCCAGC -3'
(R):5'- AAAAGAACACTGCTTGGTTCAG -3'

Sequencing Primer
(F):5'- CAGAACCTGGGAGCAGACTC -3'
(R):5'- CACTGCTTGGTTCAGTAAAATTATG -3'

Posted On

2018-05-24