Mutagenetix > Incidental Mutations

Incidental Mutation 'R6437:Samm50'

518835

Institutional Source

Beutler Lab

Gene Symbol

Samm50

Ensembl Gene

ENSMUSG00000022437

Gene Name

SAMM50 sorting and assembly machinery component

Synonyms

1110030L07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.944) question?

Stock #

R6437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84192241-84217267 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 84204097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023071]

AlphaFold

Q8BGH2

Predicted Effect

probably null
Transcript: ENSMUST00000023071

SMART Domains

Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
Pfam:Bac_surface_Ag	151	468	1.8e-68	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229751

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230498

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230659

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230830

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agrn	C	T	4: 156,176,778	V514I	probably damaging	Het
Atg16l1	T	C	1: 87,790,648	L545P	probably damaging	Het
Ces3b	T	A	8: 105,092,606	D431E	probably damaging	Het
Cracr2a	A	G	6: 127,631,831	D291G	probably damaging	Het
Csmd2	T	G	4: 127,988,100	C11G	probably benign	Het
Dido1	A	G	2: 180,675,013	I127T	probably damaging	Het
Dpp8	A	T	9: 65,074,578	Y714F	probably benign	Het
Efcab5	G	A	11: 77,137,902	A201V	probably benign	Het
Eif3h	C	T	15: 51,799,264	V129I	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fars2	G	A	13: 36,204,863	V112I	probably benign	Het
Fbn2	T	G	18: 58,113,363	D489A	probably damaging	Het
Frmd4b	G	T	6: 97,296,267	S675R	probably damaging	Het
Fsip2	C	T	2: 82,983,492	S3385F	possibly damaging	Het
Gm4758	A	G	16: 36,312,637	E92G	probably damaging	Het
Gtpbp10	A	G	5: 5,557,406	Y12H	probably damaging	Het
Kcng3	A	G	17: 83,631,129	S164P	probably damaging	Het
Kifap3	T	A	1: 163,857,526	L483Q	probably damaging	Het
Klk10	A	G	7: 43,782,817	H58R	probably benign	Het
Kntc1	T	G	5: 123,769,691	W452G	probably damaging	Het
Krt87	C	T	15: 101,438,392	D127N	possibly damaging	Het
Lipm	A	G	19: 34,121,257	Y377C	probably damaging	Het
Mrc2	G	A	11: 105,349,843	R1453H	probably damaging	Het
Nat1	T	C	8: 67,491,736	F255L	possibly damaging	Het
Neb	C	T	2: 52,257,557		probably null	Het
Nek5	T	A	8: 22,085,460	D491V	possibly damaging	Het
Nynrin	T	C	14: 55,871,770	S1445P	probably benign	Het
Olfr531	C	T	7: 140,400,521	C175Y	probably damaging	Het
Oog2	T	A	4: 144,195,108		probably null	Het
Pafah1b1	T	C	11: 74,677,731	T391A	probably benign	Het
Pcdhb7	T	C	18: 37,342,690	L293P	probably damaging	Het
Plce1	A	T	19: 38,525,132	T292S	probably benign	Het
Pold1	G	A	7: 44,538,778	R559C	probably damaging	Het
Rfx7	A	G	9: 72,618,486	Q986R	possibly damaging	Het
Rrp9	G	T	9: 106,482,951	R186L	probably benign	Het
Scoc	T	C	8: 83,437,987	D7G	probably benign	Het
Smad9	C	T	3: 54,786,084	P145S	probably benign	Het
Smc1b	C	T	15: 85,092,031	R825Q	probably benign	Het
Snrk	A	G	9: 122,166,813	R553G	probably damaging	Het
Spata5	T	A	3: 37,528,198	V794E	probably damaging	Het
Srcap	T	A	7: 127,528,550		probably null	Het
Syne2	T	A	12: 75,990,414	V3789E	possibly damaging	Het
Thsd7b	T	C	1: 129,816,682	I769T	probably damaging	Het
Tmem159	A	T	7: 120,116,361		probably null	Het
Ttc7	A	G	17: 87,330,106	K430E	probably damaging	Het
Ubr4	T	A	4: 139,397,214		probably null	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Vmn2r37	G	T	7: 9,217,851	Q338K	probably damaging	Het
Yod1	T	C	1: 130,719,148	V254A	probably damaging	Het
Zfpm2	T	C	15: 41,099,397	S152P	probably benign	Het
Zmym2	T	A	14: 56,903,004	L100H	probably damaging	Het

Other mutations in Samm50

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Samm50	APN	15	84200375	missense	possibly damaging	0.82
IGL01061:Samm50	APN	15	84202254	missense	probably benign	0.00
IGL01549:Samm50	APN	15	84202781	missense	probably benign
IGL01586:Samm50	APN	15	84195838	missense	probably benign	0.03
IGL02494:Samm50	APN	15	84195814	missense	probably benign
IGL02607:Samm50	APN	15	84207838	missense	probably benign	0.09
IGL03244:Samm50	APN	15	84214140	missense	probably benign	0.09
IGL03340:Samm50	APN	15	84198663	critical splice donor site	probably null
R0591:Samm50	UTSW	15	84211168	missense	probably benign
R0634:Samm50	UTSW	15	84214171	synonymous	silent
R1780:Samm50	UTSW	15	84211127	missense	probably damaging	0.99
R2192:Samm50	UTSW	15	84200424	critical splice donor site	probably null
R2205:Samm50	UTSW	15	84202314	missense	probably benign	0.01
R3800:Samm50	UTSW	15	84192374	missense	probably damaging	0.99
R4285:Samm50	UTSW	15	84197012	missense	probably damaging	1.00
R4333:Samm50	UTSW	15	84202830	missense	probably benign	0.02
R4780:Samm50	UTSW	15	84210610	missense	possibly damaging	0.88
R5223:Samm50	UTSW	15	84200630	missense	probably benign	0.07
R5639:Samm50	UTSW	15	84214128	missense	probably benign	0.22
R6258:Samm50	UTSW	15	84200311	missense	probably damaging	1.00
R6258:Samm50	UTSW	15	84200312	missense	probably damaging	0.98
R6452:Samm50	UTSW	15	84204097	critical splice donor site	probably benign
R6715:Samm50	UTSW	15	84211058	missense	probably benign
R6957:Samm50	UTSW	15	84198649	missense	probably damaging	1.00
R7409:Samm50	UTSW	15	84197030	missense	probably benign	0.32
R7459:Samm50	UTSW	15	84195856	critical splice donor site	probably null
R7706:Samm50	UTSW	15	84200880	splice site	probably null
R7910:Samm50	UTSW	15	84214145	missense	possibly damaging	0.49
R8421:Samm50	UTSW	15	84210585	missense	probably benign	0.04
R8443:Samm50	UTSW	15	84210501	missense	possibly damaging	0.82
R9339:Samm50	UTSW	15	84211075	missense	probably benign	0.00
X0067:Samm50	UTSW	15	84202833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGCAGCTCACTCTTCAGATG -3'
(R):5'- GACGATGGAATTCTGTGGTACC -3'

Sequencing Primer
(F):5'- ACTCTTCAGATGCTGAGCAG -3'
(R):5'- TGGTACCTGAGAGTGAGGACCC -3'

Posted On

2018-05-24