Mutagenetix > Incidental Mutation

Incidental Mutation 'R6438:Evpl'

518865

Institutional Source

Beutler Lab

Gene Symbol

Evpl

Ensembl Gene

ENSMUSG00000034282

Gene Name

envoplakin

Synonyms

210kDa protein

MMRRC Submission

044576-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6438 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116111385-116128903 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 116120927 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 436 (R436L)

Ref Sequence

ENSEMBL: ENSMUSP00000037850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037007]

AlphaFold

Q9D952

Predicted Effect

probably benign
Transcript: ENSMUST00000037007
AA Change: R436L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: R436L

Domain	Start	End	E-Value	Type
low complexity region	3	30	N/A	INTRINSIC
Blast:SPEC	44	140	1e-16	BLAST
Blast:SPEC	140	226	4e-46	BLAST
SPEC	229	330	2.21e-6	SMART
Blast:SPEC	336	500	7e-68	BLAST
low complexity region	508	525	N/A	INTRINSIC
Blast:SPEC	527	632	4e-41	BLAST
Blast:SPEC	635	746	5e-48	BLAST
Blast:SPEC	753	867	7e-49	BLAST
low complexity region	868	881	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
internal_repeat_2	1011	1030	6.54e-6	PROSPERO
internal_repeat_3	1012	1032	1.94e-5	PROSPERO
coiled coil region	1035	1077	N/A	INTRINSIC
low complexity region	1131	1144	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
PLEC	1186	1227	1.48e2	SMART
low complexity region	1228	1242	N/A	INTRINSIC
coiled coil region	1262	1366	N/A	INTRINSIC
low complexity region	1398	1414	N/A	INTRINSIC
internal_repeat_2	1457	1476	6.54e-6	PROSPERO
internal_repeat_3	1516	1536	1.94e-5	PROSPERO
low complexity region	1595	1617	N/A	INTRINSIC
PLEC	1679	1714	9.19e-4	SMART
PLEC	1729	1764	4.53e1	SMART
low complexity region	1788	1800	N/A	INTRINSIC
PLEC	1819	1856	1.41e-4	SMART
PLEC	1857	1894	5.4e-10	SMART
PLEC	1895	1932	2.7e-10	SMART
PLEC	1933	1970	1.21e-3	SMART
PLEC	1971	2008	1.16e0	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.0%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ado	A	T	10: 67,384,371 (GRCm39)	I78N	probably damaging	Het
Arhgap18	T	C	10: 26,648,694 (GRCm39)		probably null	Het
Arl11	A	G	14: 61,548,393 (GRCm39)	T68A	probably benign	Het
Atxn2	T	A	5: 121,917,495 (GRCm39)	I463N	probably damaging	Het
B3gnt4	G	A	5: 123,649,654 (GRCm39)	E340K	probably benign	Het
C1ra	C	T	6: 124,490,736 (GRCm39)	T43I	possibly damaging	Het
C6	T	A	15: 4,826,465 (GRCm39)	Y683N	possibly damaging	Het
Catspere2	T	C	1: 177,938,869 (GRCm39)	Y581H	possibly damaging	Het
Cdk12	T	A	11: 98,115,293 (GRCm39)	Y811*	probably null	Het
Cfap20dc	C	T	14: 8,431,701 (GRCm38)	V644M	probably damaging	Het
Chd9	A	T	8: 91,725,149 (GRCm39)	E1159D	probably benign	Het
Efcab7	T	A	4: 99,766,969 (GRCm39)	S505T	probably benign	Het
Erich3	A	T	3: 154,401,390 (GRCm39)	Y13F	probably damaging	Het
Esco1	A	T	18: 10,572,031 (GRCm39)	C770S	probably damaging	Het
Fam185a	T	A	5: 21,663,970 (GRCm39)		probably null	Het
Gm17078	A	G	14: 51,848,695 (GRCm39)	V14A	probably benign	Het
Hectd2	T	C	19: 36,596,242 (GRCm39)	*776Q	probably null	Het
Ldb2	T	C	5: 44,637,652 (GRCm39)	R219G	probably damaging	Het
Lrrn4	T	C	2: 132,712,062 (GRCm39)	E587G	probably damaging	Het
Malrd1	T	C	2: 15,619,017 (GRCm39)	S294P		Het
Map7	A	G	10: 20,143,003 (GRCm39)	E384G	unknown	Het
Miga1	T	C	3: 152,028,040 (GRCm39)	D163G	probably damaging	Het
Myo7b	G	A	18: 32,099,382 (GRCm39)	S1680F	probably damaging	Het
Nell2	C	T	15: 95,130,379 (GRCm39)	V665M	probably damaging	Het
Npas3	T	C	12: 54,115,481 (GRCm39)	V770A	probably damaging	Het
Pcm1	C	T	8: 41,778,418 (GRCm39)	R1818W	possibly damaging	Het
Slc4a9	T	A	18: 36,668,740 (GRCm39)	N701K	probably benign	Het
Slc5a9	A	G	4: 111,749,022 (GRCm39)	V187A	probably benign	Het
Slf1	A	T	13: 77,214,725 (GRCm39)	C654S	probably damaging	Het
Srek1ip1	A	G	13: 104,973,878 (GRCm39)	Y95C	probably benign	Het
Synpo2l	A	G	14: 20,711,204 (GRCm39)	V472A	probably benign	Het
Tmem168	A	T	6: 13,602,673 (GRCm39)	I231N	probably benign	Het
Usp34	T	C	11: 23,314,266 (GRCm39)	M717T	probably benign	Het
Zfp672	T	C	11: 58,207,563 (GRCm39)	T253A	probably benign	Het

Other mutations in Evpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Evpl	APN	11	116,125,331 (GRCm39)	missense	probably benign	0.01
IGL00896:Evpl	APN	11	116,113,410 (GRCm39)	nonsense	probably null
IGL00941:Evpl	APN	11	116,118,727 (GRCm39)	missense	probably benign	0.06
IGL01443:Evpl	APN	11	116,113,280 (GRCm39)	missense	probably damaging	1.00
IGL01523:Evpl	APN	11	116,124,270 (GRCm39)	missense	probably damaging	1.00
IGL01957:Evpl	APN	11	116,114,048 (GRCm39)	missense	probably damaging	1.00
IGL02124:Evpl	APN	11	116,117,841 (GRCm39)	missense	probably benign	0.01
IGL02334:Evpl	APN	11	116,121,850 (GRCm39)	nonsense	probably null
IGL02457:Evpl	APN	11	116,120,939 (GRCm39)	missense	possibly damaging	0.87
IGL02502:Evpl	APN	11	116,113,544 (GRCm39)	missense	probably damaging	1.00
IGL02536:Evpl	APN	11	116,112,035 (GRCm39)	missense	probably damaging	1.00
IGL02948:Evpl	APN	11	116,112,648 (GRCm39)	missense	probably damaging	1.00
IGL03183:Evpl	APN	11	116,112,438 (GRCm39)	missense	probably damaging	0.98
IGL03405:Evpl	APN	11	116,118,753 (GRCm39)	missense	possibly damaging	0.89
A4554:Evpl	UTSW	11	116,111,660 (GRCm39)	missense	probably damaging	1.00
BB005:Evpl	UTSW	11	116,113,359 (GRCm39)	missense	possibly damaging	0.63
BB015:Evpl	UTSW	11	116,113,359 (GRCm39)	missense	possibly damaging	0.63
PIT4449001:Evpl	UTSW	11	116,124,225 (GRCm39)	missense	possibly damaging	0.87
R0082:Evpl	UTSW	11	116,125,829 (GRCm39)	missense	probably damaging	1.00
R0108:Evpl	UTSW	11	116,111,702 (GRCm39)	missense	probably damaging	1.00
R0514:Evpl	UTSW	11	116,114,117 (GRCm39)	missense	probably damaging	0.99
R0581:Evpl	UTSW	11	116,120,316 (GRCm39)	missense	probably benign	0.02
R0727:Evpl	UTSW	11	116,123,311 (GRCm39)	missense	probably damaging	1.00
R0791:Evpl	UTSW	11	116,118,549 (GRCm39)	missense	probably damaging	1.00
R0792:Evpl	UTSW	11	116,118,549 (GRCm39)	missense	probably damaging	1.00
R1079:Evpl	UTSW	11	116,120,894 (GRCm39)	missense	possibly damaging	0.48
R1514:Evpl	UTSW	11	116,114,661 (GRCm39)	missense	probably benign
R1699:Evpl	UTSW	11	116,118,414 (GRCm39)	missense	probably damaging	1.00
R1717:Evpl	UTSW	11	116,116,318 (GRCm39)	missense	probably benign	0.06
R1775:Evpl	UTSW	11	116,114,486 (GRCm39)	missense	possibly damaging	0.66
R1886:Evpl	UTSW	11	116,118,402 (GRCm39)	missense	probably damaging	0.97
R1903:Evpl	UTSW	11	116,117,854 (GRCm39)	missense	probably damaging	1.00
R2081:Evpl	UTSW	11	116,125,092 (GRCm39)	missense	probably damaging	1.00
R2137:Evpl	UTSW	11	116,112,665 (GRCm39)	missense	probably damaging	0.99
R2571:Evpl	UTSW	11	116,128,795 (GRCm39)	missense	unknown
R3081:Evpl	UTSW	11	116,111,678 (GRCm39)	missense	probably damaging	1.00
R4097:Evpl	UTSW	11	116,114,003 (GRCm39)	missense	possibly damaging	0.89
R4541:Evpl	UTSW	11	116,123,470 (GRCm39)	missense	probably benign	0.01
R4562:Evpl	UTSW	11	116,124,225 (GRCm39)	missense	possibly damaging	0.87
R4703:Evpl	UTSW	11	116,113,331 (GRCm39)	missense	probably damaging	0.98
R4947:Evpl	UTSW	11	116,114,201 (GRCm39)	missense	possibly damaging	0.88
R5243:Evpl	UTSW	11	116,113,795 (GRCm39)	missense	probably damaging	1.00
R5325:Evpl	UTSW	11	116,112,191 (GRCm39)	missense	probably damaging	1.00
R5416:Evpl	UTSW	11	116,125,085 (GRCm39)	missense	probably benign	0.13
R5580:Evpl	UTSW	11	116,125,058 (GRCm39)	missense	probably benign	0.14
R5873:Evpl	UTSW	11	116,125,258 (GRCm39)	missense	probably damaging	1.00
R6298:Evpl	UTSW	11	116,121,748 (GRCm39)	missense	probably damaging	1.00
R6742:Evpl	UTSW	11	116,113,640 (GRCm39)	missense	possibly damaging	0.80
R6753:Evpl	UTSW	11	116,128,732 (GRCm39)	missense	possibly damaging	0.95
R6764:Evpl	UTSW	11	116,113,770 (GRCm39)	missense	probably damaging	0.99
R6846:Evpl	UTSW	11	116,114,633 (GRCm39)	missense	probably damaging	1.00
R7278:Evpl	UTSW	11	116,113,939 (GRCm39)	missense	probably damaging	1.00
R7288:Evpl	UTSW	11	116,114,775 (GRCm39)	missense	probably benign
R7395:Evpl	UTSW	11	116,117,905 (GRCm39)	missense	possibly damaging	0.94
R7441:Evpl	UTSW	11	116,113,782 (GRCm39)	nonsense	probably null
R7505:Evpl	UTSW	11	116,117,813 (GRCm39)	critical splice donor site	probably null
R7674:Evpl	UTSW	11	116,113,394 (GRCm39)	missense	probably benign	0.40
R7772:Evpl	UTSW	11	116,112,261 (GRCm39)	missense	probably benign	0.00
R7780:Evpl	UTSW	11	116,125,000 (GRCm39)	missense	not run
R7861:Evpl	UTSW	11	116,118,895 (GRCm39)	missense	probably damaging	1.00
R7928:Evpl	UTSW	11	116,113,359 (GRCm39)	missense	possibly damaging	0.63
R8008:Evpl	UTSW	11	116,121,298 (GRCm39)	missense	probably null	0.21
R8040:Evpl	UTSW	11	116,113,758 (GRCm39)	missense	probably damaging	0.99
R8052:Evpl	UTSW	11	116,113,989 (GRCm39)	missense	probably benign	0.00
R8402:Evpl	UTSW	11	116,116,197 (GRCm39)	missense	probably benign	0.03
R8513:Evpl	UTSW	11	116,120,570 (GRCm39)	critical splice donor site	probably null
R8695:Evpl	UTSW	11	116,114,489 (GRCm39)	missense	probably benign	0.02
R8725:Evpl	UTSW	11	116,113,019 (GRCm39)	missense	probably benign	0.25
R8749:Evpl	UTSW	11	116,120,232 (GRCm39)	missense	probably benign	0.01
R8807:Evpl	UTSW	11	116,111,853 (GRCm39)	missense	probably damaging	1.00
R8883:Evpl	UTSW	11	116,121,243 (GRCm39)	missense	probably damaging	0.99
R8947:Evpl	UTSW	11	116,112,164 (GRCm39)	missense	probably damaging	1.00
R9123:Evpl	UTSW	11	116,115,008 (GRCm39)	missense	possibly damaging	0.62
R9314:Evpl	UTSW	11	116,118,503 (GRCm39)	missense	probably benign	0.13
R9581:Evpl	UTSW	11	116,120,660 (GRCm39)	missense	probably benign	0.30
R9665:Evpl	UTSW	11	116,123,497 (GRCm39)	missense	probably damaging	1.00
R9688:Evpl	UTSW	11	116,124,986 (GRCm39)	missense	probably damaging	1.00
R9756:Evpl	UTSW	11	116,112,077 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAAGCATTGGCCCTGGTG -3'
(R):5'- AGTATGAGCCCTACCTGCCTTC -3'

Sequencing Primer
(F):5'- TGCGTGTGGGCATCCTG -3'
(R):5'- ACACTGCTTCAGTCCCTAAC -3'

Posted On

2018-05-24