Incidental Mutation 'R6438:Gm17078'
ID518870
Institutional Source Beutler Lab
Gene Symbol Gm17078
Ensembl Gene ENSMUSG00000094715
Gene Namepredicted gene 17078
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6438 (G1)
Quality Score170.009
Status Validated
Chromosome14
Chromosomal Location51606807-51611310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51611238 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000137655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096170] [ENSMUST00000167617]
Predicted Effect probably benign
Transcript: ENSMUST00000096170
SMART Domains Protein: ENSMUSP00000093884
Gene: ENSMUSG00000079244

DomainStartEndE-ValueType
Pfam:Takusan 56 144 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167617
AA Change: V14A

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137655
Gene: ENSMUSG00000094715
AA Change: V14A

DomainStartEndE-ValueType
Pfam:Takusan 53 136 4.5e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik C T 14: 8,431,701 V644M probably damaging Het
Ado A T 10: 67,548,541 I78N probably damaging Het
Arhgap18 T C 10: 26,772,698 probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atxn2 T A 5: 121,779,432 I463N probably damaging Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
C1ra C T 6: 124,513,777 T43I possibly damaging Het
C6 T A 15: 4,796,983 Y683N possibly damaging Het
Cdk12 T A 11: 98,224,467 Y811* probably null Het
Chd9 A T 8: 90,998,521 E1159D probably benign Het
Efcab7 T A 4: 99,909,772 S505T probably benign Het
Erich3 A T 3: 154,695,753 Y13F probably damaging Het
Esco1 A T 18: 10,572,031 C770S probably damaging Het
Evpl C A 11: 116,230,101 R436L probably benign Het
Fam185a T A 5: 21,458,972 probably null Het
Gm16432 T C 1: 178,111,303 Y581H possibly damaging Het
Hectd2 T C 19: 36,618,842 *776Q probably null Het
Ldb2 T C 5: 44,480,310 R219G probably damaging Het
Lrrn4 T C 2: 132,870,142 E587G probably damaging Het
Malrd1 T C 2: 15,614,206 S294P probably benign Het
Map7 A G 10: 20,267,257 E384G unknown Het
Miga1 T C 3: 152,322,403 D163G probably damaging Het
Myo7b G A 18: 31,966,329 S1680F probably damaging Het
Nell2 C T 15: 95,232,498 V665M probably damaging Het
Npas3 T C 12: 54,068,698 V770A probably damaging Het
Pcm1 C T 8: 41,325,381 R1818W possibly damaging Het
Slc4a9 T A 18: 36,535,687 N701K probably benign Het
Slc5a9 A G 4: 111,891,825 V187A probably benign Het
Slf1 A T 13: 77,066,606 C654S probably damaging Het
Srek1ip1 A G 13: 104,837,370 Y95C probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Tmem168 A T 6: 13,602,674 I231N probably benign Het
Usp34 T C 11: 23,364,266 M717T probably benign Het
Zfp672 T C 11: 58,316,737 T253A probably benign Het
Other mutations in Gm17078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02525:Gm17078 APN 14 51611223 missense possibly damaging 0.94
IGL02983:Gm17078 APN 14 51611190 missense probably benign 0.00
R5028:Gm17078 UTSW 14 51611242 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TGGCTCTACCATTGAGGAATCTG -3'
(R):5'- CAGTAGGCCATGGAAGTTCC -3'

Sequencing Primer
(F):5'- CTACCATTGAGGAATCTGAAGGATCC -3'
(R):5'- GTTCCAGGTTACATCATCAGGAGTC -3'
Posted On2018-05-24