Incidental Mutation 'R6438:Hectd2'
ID518877
Institutional Source Beutler Lab
Gene Symbol Hectd2
Ensembl Gene ENSMUSG00000041180
Gene NameHECT domain E3 ubiquitin protein ligase 2
SynonymsA630025O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6438 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location36554639-36621135 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 36618842 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 776 (*776Q)
Ref Sequence ENSEMBL: ENSMUSP00000128387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047247] [ENSMUST00000139215] [ENSMUST00000169036] [ENSMUST00000177381]
Predicted Effect probably null
Transcript: ENSMUST00000047247
AA Change: *775Q
SMART Domains Protein: ENSMUSP00000042646
Gene: ENSMUSG00000041180
AA Change: *775Q

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 433 774 1.33e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129953
Predicted Effect probably benign
Transcript: ENSMUST00000139215
SMART Domains Protein: ENSMUSP00000117273
Gene: ENSMUSG00000041180

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149601
Predicted Effect probably benign
Transcript: ENSMUST00000155594
SMART Domains Protein: ENSMUSP00000120791
Gene: ENSMUSG00000041180

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
low complexity region 82 101 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169036
AA Change: *776Q
SMART Domains Protein: ENSMUSP00000128387
Gene: ENSMUSG00000041180
AA Change: *776Q

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 434 775 1.33e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177381
SMART Domains Protein: ENSMUSP00000134964
Gene: ENSMUSG00000041180

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik C T 14: 8,431,701 V644M probably damaging Het
Ado A T 10: 67,548,541 I78N probably damaging Het
Arhgap18 T C 10: 26,772,698 probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atxn2 T A 5: 121,779,432 I463N probably damaging Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
C1ra C T 6: 124,513,777 T43I possibly damaging Het
C6 T A 15: 4,796,983 Y683N possibly damaging Het
Cdk12 T A 11: 98,224,467 Y811* probably null Het
Chd9 A T 8: 90,998,521 E1159D probably benign Het
Efcab7 T A 4: 99,909,772 S505T probably benign Het
Erich3 A T 3: 154,695,753 Y13F probably damaging Het
Esco1 A T 18: 10,572,031 C770S probably damaging Het
Evpl C A 11: 116,230,101 R436L probably benign Het
Fam185a T A 5: 21,458,972 probably null Het
Gm16432 T C 1: 178,111,303 Y581H possibly damaging Het
Gm17078 A G 14: 51,611,238 V14A probably benign Het
Ldb2 T C 5: 44,480,310 R219G probably damaging Het
Lrrn4 T C 2: 132,870,142 E587G probably damaging Het
Malrd1 T C 2: 15,614,206 S294P Het
Map7 A G 10: 20,267,257 E384G unknown Het
Miga1 T C 3: 152,322,403 D163G probably damaging Het
Myo7b G A 18: 31,966,329 S1680F probably damaging Het
Nell2 C T 15: 95,232,498 V665M probably damaging Het
Npas3 T C 12: 54,068,698 V770A probably damaging Het
Pcm1 C T 8: 41,325,381 R1818W possibly damaging Het
Slc4a9 T A 18: 36,535,687 N701K probably benign Het
Slc5a9 A G 4: 111,891,825 V187A probably benign Het
Slf1 A T 13: 77,066,606 C654S probably damaging Het
Srek1ip1 A G 13: 104,837,370 Y95C probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Tmem168 A T 6: 13,602,674 I231N probably benign Het
Usp34 T C 11: 23,364,266 M717T probably benign Het
Zfp672 T C 11: 58,316,737 T253A probably benign Het
Other mutations in Hectd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Hectd2 APN 19 36584936 missense probably benign
IGL01024:Hectd2 APN 19 36606393 missense probably damaging 1.00
IGL01111:Hectd2 APN 19 36597120 missense probably damaging 1.00
IGL01301:Hectd2 APN 19 36569370 splice site probably benign
IGL02019:Hectd2 APN 19 36615516 missense possibly damaging 0.94
IGL02410:Hectd2 APN 19 36595213 nonsense probably null
IGL02793:Hectd2 APN 19 36587421 missense probably damaging 0.99
IGL03010:Hectd2 APN 19 36615602 missense probably benign 0.01
IGL03115:Hectd2 APN 19 36599721 critical splice donor site probably null
IGL03251:Hectd2 APN 19 36585526 missense probably damaging 1.00
chopstix1 UTSW 19 36609416 missense possibly damaging 0.75
Chopstix3 UTSW 19 36615508 nonsense probably null
R0402:Hectd2 UTSW 19 36601529 critical splice donor site probably null
R0415:Hectd2 UTSW 19 36584884 unclassified probably benign
R0576:Hectd2 UTSW 19 36585497 missense probably benign
R0685:Hectd2 UTSW 19 36569431 missense probably damaging 0.99
R1460:Hectd2 UTSW 19 36615508 nonsense probably null
R1791:Hectd2 UTSW 19 36609416 missense possibly damaging 0.75
R1895:Hectd2 UTSW 19 36614460 missense probably damaging 1.00
R1928:Hectd2 UTSW 19 36612319 missense probably damaging 1.00
R2116:Hectd2 UTSW 19 36614424 missense probably damaging 0.99
R2520:Hectd2 UTSW 19 36612233 critical splice donor site probably null
R4693:Hectd2 UTSW 19 36614338 splice site probably benign
R4858:Hectd2 UTSW 19 36605282 missense probably damaging 0.98
R4943:Hectd2 UTSW 19 36604247 splice site probably null
R5031:Hectd2 UTSW 19 36599604 missense probably damaging 1.00
R5408:Hectd2 UTSW 19 36554896 missense possibly damaging 0.46
R5621:Hectd2 UTSW 19 36618751 missense probably damaging 1.00
R5652:Hectd2 UTSW 19 36604320 missense probably damaging 1.00
R5704:Hectd2 UTSW 19 36598891 missense possibly damaging 0.93
R5950:Hectd2 UTSW 19 36597239 intron probably benign
R6414:Hectd2 UTSW 19 36618786 missense probably benign 0.21
R6544:Hectd2 UTSW 19 36612328 missense probably damaging 1.00
R6545:Hectd2 UTSW 19 36587378 missense probably benign 0.35
R6629:Hectd2 UTSW 19 36615538 missense probably damaging 1.00
R6672:Hectd2 UTSW 19 36587380 missense probably damaging 1.00
R6741:Hectd2 UTSW 19 36612359 missense probably damaging 1.00
R7117:Hectd2 UTSW 19 36599655 missense probably benign 0.29
R7238:Hectd2 UTSW 19 36597078 missense probably damaging 0.98
R7555:Hectd2 UTSW 19 36612403 missense probably damaging 1.00
R8184:Hectd2 UTSW 19 36604354 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAGGAAAGTAGATCTCAATGTATGC -3'
(R):5'- CTCAGACCTGTTTCTGCCATAGG -3'

Sequencing Primer
(F):5'- CTGTGGCACACACTTGT -3'
(R):5'- GTGGTGAGCTTTGAGAAAG -3'
Posted On2018-05-24