Incidental Mutation 'R6404:Olfr1226'
ID518881
Institutional Source Beutler Lab
Gene Symbol Olfr1226
Ensembl Gene ENSMUSG00000075097
Gene Nameolfactory receptor 1226
SynonymsGA_x6K02T2Q125-50672630-50671698, MOR233-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89188839-89200048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89193562 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 157 (I157M)
Ref Sequence ENSEMBL: ENSMUSP00000151855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099790] [ENSMUST00000214709] [ENSMUST00000215562] [ENSMUST00000215987] [ENSMUST00000216445] [ENSMUST00000217601] [ENSMUST00000220416]
Predicted Effect probably damaging
Transcript: ENSMUST00000099790
AA Change: I157M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097378
Gene: ENSMUSG00000075097
AA Change: I157M

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 6.5e-47 PFAM
Pfam:7tm_1 39 285 3.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214709
AA Change: I157M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215562
AA Change: I157M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215987
AA Change: I157M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216445
AA Change: I157M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217601
AA Change: I157M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000220416
AA Change: I157M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Olfr1226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Olfr1226 APN 2 89193504 missense probably benign 0.00
IGL01073:Olfr1226 APN 2 89193137 missense possibly damaging 0.78
IGL01539:Olfr1226 APN 2 89193492 missense possibly damaging 0.81
IGL01549:Olfr1226 APN 2 89193789 missense probably benign 0.01
IGL02040:Olfr1226 APN 2 89193563 missense probably benign 0.16
IGL02174:Olfr1226 APN 2 89193368 missense probably benign 0.01
IGL02322:Olfr1226 APN 2 89193462 missense probably damaging 0.99
IGL02881:Olfr1226 APN 2 89193641 missense probably damaging 1.00
IGL03336:Olfr1226 APN 2 89193897 missense probably benign 0.16
R1565:Olfr1226 UTSW 2 89193883 missense probably damaging 0.99
R3429:Olfr1226 UTSW 2 89193273 missense probably benign 0.04
R5668:Olfr1226 UTSW 2 89193826 missense possibly damaging 0.60
R6418:Olfr1226 UTSW 2 89193479 missense probably damaging 0.97
R7039:Olfr1226 UTSW 2 89193446 missense probably damaging 0.96
R7863:Olfr1226 UTSW 2 89193951 missense probably benign
R7946:Olfr1226 UTSW 2 89193951 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAACTGTGGGCTCTCAGAG -3'
(R):5'- TGCATGACACAACTGTTTGC -3'

Sequencing Primer
(F):5'- TCTCAGAGAGAACAAGATGACAC -3'
(R):5'- ATGACACAACTGTTTGCTGTGCAC -3'
Posted On2018-05-24