Incidental Mutation 'R6404:Frmd5'
ID518882
Institutional Source Beutler Lab
Gene Symbol Frmd5
Ensembl Gene ENSMUSG00000027238
Gene NameFERM domain containing 5
SynonymsA930004K21Rik, 1500032A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121545529-121807087 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 121549218 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 70 (R70*)
Ref Sequence ENSEMBL: ENSMUSP00000148465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110592] [ENSMUST00000110593] [ENSMUST00000110602] [ENSMUST00000121219] [ENSMUST00000128428] [ENSMUST00000138157] [ENSMUST00000155570] [ENSMUST00000212518]
Predicted Effect probably null
Transcript: ENSMUST00000110592
AA Change: R384*
SMART Domains Protein: ENSMUSP00000106222
Gene: ENSMUSG00000027238
AA Change: R384*

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110593
AA Change: R376*
SMART Domains Protein: ENSMUSP00000106223
Gene: ENSMUSG00000027238
AA Change: R376*

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
low complexity region 489 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110602
SMART Domains Protein: ENSMUSP00000106232
Gene: ENSMUSG00000027242

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 137 154 N/A INTRINSIC
WD40 205 244 8.59e-1 SMART
WD40 249 289 1.63e-4 SMART
WD40 292 331 1.98e1 SMART
WD40 336 375 4.75e1 SMART
WD40 383 423 9.24e-4 SMART
low complexity region 424 435 N/A INTRINSIC
WD40 479 520 2.28e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121219
AA Change: R295*
SMART Domains Protein: ENSMUSP00000113568
Gene: ENSMUSG00000027238
AA Change: R295*

DomainStartEndE-ValueType
B41 1 121 1.92e-4 SMART
FERM_C 125 213 6.86e-24 SMART
FA 219 265 1.45e-13 SMART
low complexity region 363 385 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128428
SMART Domains Protein: ENSMUSP00000116468
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 13 202 3.21e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131092
AA Change: R74*
SMART Domains Protein: ENSMUSP00000118272
Gene: ENSMUSG00000027238
AA Change: R74*

DomainStartEndE-ValueType
FA 2 45 2.55e-9 SMART
low complexity region 143 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133898
AA Change: R302*
SMART Domains Protein: ENSMUSP00000118269
Gene: ENSMUSG00000027238
AA Change: R302*

DomainStartEndE-ValueType
B41 1 129 8.68e-9 SMART
FERM_C 133 221 6.86e-24 SMART
FA 227 273 1.45e-13 SMART
low complexity region 371 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138157
AA Change: R384*
SMART Domains Protein: ENSMUSP00000115136
Gene: ENSMUSG00000027238
AA Change: R384*

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153932
Predicted Effect probably null
Transcript: ENSMUST00000155570
AA Change: R376*
SMART Domains Protein: ENSMUSP00000120176
Gene: ENSMUSG00000027238
AA Change: R376*

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212518
AA Change: R70*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Frmd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03025:Frmd5 APN 2 121553344 missense probably benign
big_rip UTSW 2 121549218 nonsense probably null
PIT4812001:Frmd5 UTSW 2 121586446 missense probably benign 0.34
R0385:Frmd5 UTSW 2 121555574 missense probably damaging 1.00
R1667:Frmd5 UTSW 2 121548730 frame shift probably null
R4243:Frmd5 UTSW 2 121562882 splice site probably null
R4590:Frmd5 UTSW 2 121765031 splice site probably null
R4705:Frmd5 UTSW 2 121562863 intron probably benign
R4909:Frmd5 UTSW 2 121591653 splice site probably null
R4935:Frmd5 UTSW 2 121562924 missense possibly damaging 0.75
R5008:Frmd5 UTSW 2 121548860 missense probably damaging 1.00
R5095:Frmd5 UTSW 2 121548921 missense possibly damaging 0.95
R5431:Frmd5 UTSW 2 121562909 missense probably damaging 1.00
R5875:Frmd5 UTSW 2 121558478 intron probably benign
R6246:Frmd5 UTSW 2 121551048 missense possibly damaging 0.66
R7039:Frmd5 UTSW 2 121547647 unclassified probably benign
R7072:Frmd5 UTSW 2 121557870 missense probably damaging 0.97
R7520:Frmd5 UTSW 2 121554264 critical splice donor site probably null
R7804:Frmd5 UTSW 2 121591744 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTCAATGCTGCACGTGG -3'
(R):5'- AAATGTCCACTGGGTACTTCTTTTG -3'

Sequencing Primer
(F):5'- TTGATCTGCCGGGAGAGC -3'
(R):5'- GCCCTGTTCTTGATGTCTGCATATG -3'
Posted On2018-05-24