Incidental Mutation 'R6404:Cc2d2a'
ID518888
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43704074 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 660 (N660D)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048150
AA Change: N660D

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: N660D

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125866
AA Change: N611D

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: N611D

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127355
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCTTCTACCCAACAGAGG -3'
(R):5'- AGTTCAACCTCATGTTTATGCATGG -3'

Sequencing Primer
(F):5'- CCCAACAGAGGGCCAAAAAGAAG -3'
(R):5'- CATGGTTCTTCTGTTCATATGGC -3'
Posted On2018-05-24