Incidental Mutation 'R6404:Cd3e'
ID518896
Institutional Source Beutler Lab
Gene Symbol Cd3e
Ensembl Gene ENSMUSG00000032093
Gene NameCD3 antigen, epsilon polypeptide
SynonymsT3e, CD3, CD3epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44998740-45009627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45001128 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 106 (E106V)
Ref Sequence ENSEMBL: ENSMUSP00000099896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102832]
PDB Structure
CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct [SOLUTION NMR]
CD3 EPSILON AND DELTA ECTODOMAIN FRAGMENT COMPLEX IN SINGLE-CHAIN CONSTRUCT [SOLUTION NMR]
Mouse CD3epsilon Cytoplasmic Tail [SOLUTION NMR]
Crystal structure of mouse cd3epsilon in complex with antibody 2C11 Fab [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102832
AA Change: E106V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099896
Gene: ENSMUSG00000032093
AA Change: E106V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 33 90 3.79e-13 SMART
transmembrane domain 111 133 N/A INTRINSIC
ITAM 167 187 2.96e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214762
Meta Mutation Damage Score 0.7763 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. Defects in this gene cause immunodeficiency. This gene has also been linked to a susceptibility to type I diabetes in women. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous null for this mutation lack peripherial T cells and have a block of thymocyte development at the DN3 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Cd3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
cadence UTSW 9 45001128 missense probably damaging 1.00
tumormouse UTSW 9 45006150 intron probably benign
R0504:Cd3e UTSW 9 45002254 missense probably benign
R3237:Cd3e UTSW 9 45002310 nonsense probably null
R6054:Cd3e UTSW 9 45002161 missense possibly damaging 0.87
R6374:Cd3e UTSW 9 45009363 missense probably benign 0.41
R6701:Cd3e UTSW 9 45001053 missense probably damaging 1.00
R7403:Cd3e UTSW 9 45002292 missense probably benign 0.00
X0025:Cd3e UTSW 9 45000976 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAATCTGCTGTAGACTTGGTGC -3'
(R):5'- TCCTCATTGGACACCACTGC -3'

Sequencing Primer
(F):5'- AGGCTAGATGTCTCCTGACC -3'
(R):5'- CCACTGCAGGAAAGACTCTGG -3'
Posted On2018-05-24