Incidental Mutation 'R6404:Lilr4b'
ID518901
Institutional Source Beutler Lab
Gene Symbol Lilr4b
Ensembl Gene ENSMUSG00000112023
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4B
SynonymsGp49a, gp49
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location51480632-51486703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51485729 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 199 (D199G)
Ref Sequence ENSEMBL: ENSMUSP00000151625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102894] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218704] [ENSMUST00000219661] [ENSMUST00000219696] [ENSMUST00000219960]
Predicted Effect probably damaging
Transcript: ENSMUST00000102894
AA Change: D294G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099958
Gene: ENSMUSG00000112023
AA Change: D294G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1nkr_2 24 118 3e-14 SMART
Blast:IG_like 28 118 5e-49 BLAST
Pfam:Ig_3 123 200 6.5e-8 PFAM
Pfam:Ig_2 123 218 5.9e-8 PFAM
Pfam:ig 127 211 8.4e-9 PFAM
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217706
Predicted Effect probably benign
Transcript: ENSMUST00000218123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218649
Predicted Effect probably benign
Transcript: ENSMUST00000218704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219598
Predicted Effect probably damaging
Transcript: ENSMUST00000219661
AA Change: D199G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219828
Predicted Effect probably benign
Transcript: ENSMUST00000219960
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Lilr4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Lilr4b APN 10 51481251 missense probably benign 0.00
IGL02457:Lilr4b APN 10 51481238 missense probably benign 0.04
IGL03221:Lilr4b APN 10 51481428 splice site probably benign
IGL03396:Lilr4b APN 10 51481157 missense possibly damaging 0.71
R0145:Lilr4b UTSW 10 51484518 missense probably benign 0.00
R0336:Lilr4b UTSW 10 51481293 missense probably benign 0.28
R1313:Lilr4b UTSW 10 51480736 missense probably benign 0.25
R1543:Lilr4b UTSW 10 51481421 missense probably damaging 0.98
R1984:Lilr4b UTSW 10 51481735 missense possibly damaging 0.68
R1985:Lilr4b UTSW 10 51481735 missense possibly damaging 0.68
R2243:Lilr4b UTSW 10 51481608 missense possibly damaging 0.88
R4094:Lilr4b UTSW 10 51481410 missense probably damaging 0.99
R4887:Lilr4b UTSW 10 51484520 missense possibly damaging 0.81
R5588:Lilr4b UTSW 10 51481326 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGATACAGTCCTCAGACATG -3'
(R):5'- CTTTGCATGCAGTGTCCTGG -3'

Sequencing Primer
(F):5'- TCCTCAGACATGAAAATGGGAATC -3'
(R):5'- CAGTGTCCTGGGGTTGGATAGAG -3'
Posted On2018-05-24