Incidental Mutation 'R6404:Ccdc57'
ID518906
Institutional Source Beutler Lab
Gene Symbol Ccdc57
Ensembl Gene ENSMUSG00000048445
Gene Namecoiled-coil domain containing 57
Synonyms4933434G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120826529-120932872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120894712 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 466 (T466A)
Ref Sequence ENSEMBL: ENSMUSP00000050996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056781]
Predicted Effect probably benign
Transcript: ENSMUST00000056781
AA Change: T466A

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050996
Gene: ENSMUSG00000048445
AA Change: T466A

DomainStartEndE-ValueType
coiled coil region 14 174 N/A INTRINSIC
coiled coil region 198 350 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
coiled coil region 380 489 N/A INTRINSIC
coiled coil region 519 548 N/A INTRINSIC
coiled coil region 575 607 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
internal_repeat_1 657 677 1.17e-5 PROSPERO
low complexity region 763 774 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
internal_repeat_1 863 883 1.17e-5 PROSPERO
low complexity region 915 923 N/A INTRINSIC
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Ccdc57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ccdc57 APN 11 120860469 missense possibly damaging 0.94
IGL01069:Ccdc57 APN 11 120861259 missense probably benign 0.06
IGL02065:Ccdc57 APN 11 120873760 missense possibly damaging 0.85
IGL02143:Ccdc57 APN 11 120861243 nonsense probably null
R0265:Ccdc57 UTSW 11 120921811 missense probably benign 0.00
R1184:Ccdc57 UTSW 11 120873811 splice site probably benign
R1792:Ccdc57 UTSW 11 120897881 missense possibly damaging 0.82
R1834:Ccdc57 UTSW 11 120861219 missense probably benign 0.07
R1852:Ccdc57 UTSW 11 120921673 missense probably damaging 0.98
R1914:Ccdc57 UTSW 11 120903308 splice site probably benign
R2146:Ccdc57 UTSW 11 120885225 splice site probably benign
R2341:Ccdc57 UTSW 11 120860523 missense probably benign 0.00
R3013:Ccdc57 UTSW 11 120861199 missense probably benign 0.01
R4798:Ccdc57 UTSW 11 120881857 missense possibly damaging 0.73
R4821:Ccdc57 UTSW 11 120860399 critical splice donor site probably null
R4869:Ccdc57 UTSW 11 120903518 splice site probably null
R4964:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R4966:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R5204:Ccdc57 UTSW 11 120886062 missense possibly damaging 0.73
R5993:Ccdc57 UTSW 11 120894724 missense possibly damaging 0.85
R6072:Ccdc57 UTSW 11 120902075 missense probably damaging 0.98
R6877:Ccdc57 UTSW 11 120873702 missense probably benign 0.00
R7074:Ccdc57 UTSW 11 120903374 missense possibly damaging 0.94
R7102:Ccdc57 UTSW 11 120921731 nonsense probably null
R7311:Ccdc57 UTSW 11 120873741 missense probably benign
R8087:Ccdc57 UTSW 11 120897879 missense probably benign
R8111:Ccdc57 UTSW 11 120878887 missense probably damaging 0.99
R8164:Ccdc57 UTSW 11 120897962 missense probably benign 0.00
R8273:Ccdc57 UTSW 11 120921773 missense probably damaging 1.00
R8316:Ccdc57 UTSW 11 120885916 missense probably damaging 0.98
R8323:Ccdc57 UTSW 11 120897924 missense possibly damaging 0.66
R8388:Ccdc57 UTSW 11 120826918 missense probably benign
R8768:Ccdc57 UTSW 11 120897962 missense probably benign 0.00
R8957:Ccdc57 UTSW 11 120886035 missense probably benign
Z1176:Ccdc57 UTSW 11 120860488 missense possibly damaging 0.89
Z1176:Ccdc57 UTSW 11 120861138 missense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCTGTCATCGAAAGGG -3'
(R):5'- TAAGTGGACAGGAAAGCCCTCC -3'

Sequencing Primer
(F):5'- TGGACTGAGAAAGCCTGGCC -3'
(R):5'- GGAAAGCCCTCCCCCAC -3'
Posted On2018-05-24