Incidental Mutation 'R6404:Iqgap2'
ID518909
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95729477 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 298 (I298T)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably benign
Transcript: ENSMUST00000068603
AA Change: I298T

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: I298T

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGGAAACCGTGGGATATCAC -3'
(R):5'- AGCCTTGTCCACAGATCAGC -3'

Sequencing Primer
(F):5'- TGGGATATCACGTCACAATGAC -3'
(R):5'- ATGGAGCAGGTATCCCACG -3'
Posted On2018-05-24